EMAIL THIS PAGE TO A FRIEND

TUBB

tubulin, beta class I

Synonyms: M40 OK/SW-cl.56 TUBB1 TUBB5
UniProtKB ID: P07437, P05218, Q8WUC1, Q9CY33
Gene ID:
chicken(396254) tubulin, beta class I
domestic cat(101095657) tubulin, beta class I
dog(474830) tubulin, beta 2A class IIa
cow(615087) tubulin, beta class I
cow(533307) tubulin, beta
Gene Class: Cytoskeleton
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4200732 Anti-β-Tubulin I antibody, Mouse monoclonal clone SAP.4G5, purified from hybridoma cell culture New rat, bovine, canine, chicken, Xenopus, hamster, gerbil, human, mouse, monkey
immunofluorescence, immunohistochemistry, western blot pricing
SAB4301801 Anti-TUBB affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB2108247 Anti-TUBB antibody produced in rabbit affinity isolated antibody rabbit, human, zebrafish, canine, horse, guinea pig, pig, mouse, bovine, rat
western blot pricing
HPA046280 Anti-TUBB antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, human, mouse
immunohistochemistry, western blot pricing
GW21263 Anti-TUBB2A antibody produced in chicken affinity isolated antibody, buffered aqueous solution human, rat, mouse
western blot pricing
T8328 Monoclonal Anti-β-Tubulin antibody produced in mouse ~2.0 mg/mL, clone AA2, purified immunoglobulin, buffered aqueous solution bovine, human, mouse, rat
immunocytochemistry, immunohistochemistry, immunoprecipitation, western blot pricing
T7816 Monoclonal Anti-β-Tubulin I antibody produced in mouse clone SAP.4G5, ascites fluid canine, hamster, human, Xenopus, rat, bovine, mouse, chicken
ELISA, immunocytochemistry, immunohistochemistry, microarray, western blot pricing
SAB1305556 MONOCLONAL ANTI-TBB5 antibody produced in mouse clone 87CT59.3.7, IgG fraction of antiserum, buffered aqueous solution mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
WH0203068M4 Monoclonal Anti-TUBB antibody produced in mouse clone 3B3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
T9822 Monoclonal Anti-Tubulin, Polyglutamylated antibody produced in mouse clone B3, purified from hybridoma cell culture mouse, Oxyrrhis marina (dinoflagellate), sea urchin (Lytechinus pictus and three others.), chicken, human, bovine, rabbit, rat, monkey
ELISA, immunocytochemistry, microarray, western blot pricing
T9028 Monoclonal Anti-Tubulin, Tyrosine antibody produced in mouse clone TUB-1A2, ascites fluid plant, animal, human
immunofluorescence, microarray, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
M1404 Nocodazole ≥99% (TLC), powder human pricing

AQUA Peptides

Product # Description Species Add to Cart
 
AQ0078 AQUA Peptide FPGQLNADL[R] African clawed frog, cow, honey bee, human, mouse, rat pricing
AQ0079 AQUA Peptide YLTVAAVF[R] Drosophila melanogaster, African clawed frog, chicken, cow, dog, honey bee, human, mouse, rat, sheep pricing
AQ0828 AQUA Peptide EIVHIQAGQ(CAM)GNQIGA[K] human, mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178014 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178014 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178014 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU108701 MISSION® esiRNA esiRNA human AL662848.6-201 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178014 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178014 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369496 predicted 1961
2 SASI_Hs02_00369497 predicted 1928
3 SASI_Hs02_00369498 predicted 1922
4 SASI_Hs01_00043068 predicted 1944
5 SASI_Hs02_00369499 predicted 1142
6 SASI_Hs02_00369500 predicted 1862
7 SASI_Hs02_00369501 predicted 1929
8 SASI_Hs01_00043069 predicted 959
9 SASI_Hs01_00043070 predicted 706
10 SASI_Hs01_00043071 predicted 348
11 SASI_Hs01_00043072 predicted 459
12 SASI_Hs01_00043073 predicted 584
13 SASI_Hs01_00043074 predicted 377
14 SASI_Hs01_00043075 predicted 699
15 SASI_Hs01_00043076 predicted 389
16 SASI_Hs01_00043077 predicted 702
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178014
VALIDATED
TUBB MISSION shRNA Bacterial Glycerol Stock
tubulin, beta class I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000074358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1617s1c1
Sequence:CCGGGCGCTCAATAAATACTTGTTTCTCGAGAAACAAGTATTTATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-263s1c1
Sequence:CCGGCGCATCTCTGTGTACTACAATCTCGAGATTGTAGTACACAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1217s1c1
Sequence:CCGGGCAGTCACCTTCATTGGCAATCTCGAGATTGCCAATGAAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178014.2-595s1c1
Sequence:CCGGAGAAGAATACCCTGATCGCATCTCGAGATGCGATCAGGGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000074360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1111s1c1
Sequence:CCGGGCAGATGCTTAACGTGCAGAACTCGAGTTCTGCACGTTAAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-263s21c1
Sequence:CCGGCGCATCTCTGTGTACTACAATCTCGAGATTGTAGTACACAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-1111s21c1
Sequence:CCGGGCAGATGCTTAACGTGCAGAACTCGAGTTCTGCACGTTAAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-1217s21c1
Sequence:CCGGGCAGTCACCTTCATTGGCAATCTCGAGATTGCCAATGAAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178014.2-1617s21c1
Sequence:CCGGGCGCTCAATAAATACTTGTTTCTCGAGAAACAAGTATTTATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178014
VALIDATED
TUBB MISSION shRNA shRNA Plasmid DNA
tubulin, beta class I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000074358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1617s1c1
Sequence:CCGGGCGCTCAATAAATACTTGTTTCTCGAGAAACAAGTATTTATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-263s1c1
Sequence:CCGGCGCATCTCTGTGTACTACAATCTCGAGATTGTAGTACACAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1217s1c1
Sequence:CCGGGCAGTCACCTTCATTGGCAATCTCGAGATTGCCAATGAAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178014.2-595s1c1
Sequence:CCGGAGAAGAATACCCTGATCGCATCTCGAGATGCGATCAGGGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000074360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1111s1c1
Sequence:CCGGGCAGATGCTTAACGTGCAGAACTCGAGTTCTGCACGTTAAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-263s21c1
Sequence:CCGGCGCATCTCTGTGTACTACAATCTCGAGATTGTAGTACACAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-1111s21c1
Sequence:CCGGGCAGATGCTTAACGTGCAGAACTCGAGTTCTGCACGTTAAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-1217s21c1
Sequence:CCGGGCAGTCACCTTCATTGGCAATCTCGAGATTGCCAATGAAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178014.2-1617s21c1
Sequence:CCGGGCGCTCAATAAATACTTGTTTCTCGAGAAACAAGTATTTATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178014
VALIDATED
TUBB MISSION shRNA Lentiviral Transduction Particles
tubulin, beta class I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000074358    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1617s1c1
Sequence:CCGGGCGCTCAATAAATACTTGTTTCTCGAGAAACAAGTATTTATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074359    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-263s1c1
Sequence:CCGGCGCATCTCTGTGTACTACAATCTCGAGATTGTAGTACACAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074361    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1217s1c1
Sequence:CCGGGCAGTCACCTTCATTGGCAATCTCGAGATTGCCAATGAAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178014.2-595s1c1
Sequence:CCGGAGAAGAATACCCTGATCGCATCTCGAGATGCGATCAGGGTATTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000074360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: MCF7
TRC Version: 1 Clone ID:NM_178014.2-1111s1c1
Sequence:CCGGGCAGATGCTTAACGTGCAGAACTCGAGTTCTGCACGTTAAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311722    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-263s21c1
Sequence:CCGGCGCATCTCTGTGTACTACAATCTCGAGATTGTAGTACACAGAGATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-1111s21c1
Sequence:CCGGGCAGATGCTTAACGTGCAGAACTCGAGTTCTGCACGTTAAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178014.2-1217s21c1
Sequence:CCGGGCAGTCACCTTCATTGGCAATCTCGAGATTGCCAATGAAGGTGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311723    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178014.2-1617s21c1
Sequence:CCGGGCGCTCAATAAATACTTGTTTCTCGAGAAACAAGTATTTATTGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks