EMAIL THIS PAGE TO A FRIEND

TUBD1

tubulin, delta 1

Synonyms: TUBD
Gene ID:
Mouse(56427) tubulin, delta 1
Rat(287592) tubulin, delta 1
Zebrafish(415183) tubulin, delta 1
domestic cat(101092969) tubulin, delta 1
dog(403546) tubulin, delta 1
chicken(417636) tubulin, delta 1
cow(510838) tubulin, delta 1
sheep(101106182) tubulin, delta 1
naked mole-rat(101722316) tubulin, delta 1
Gene Class: Cytoskeleton
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016261 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016261 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016261 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019756 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019756 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019756 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016261 Rosetta Predictions human pricing
NM_001105826 Rosetta Predictions rat pricing
NM_019756 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016261 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124636 predicted 985
2 SASI_Hs01_00124638 predicted 1381
3 SASI_Hs01_00124639 predicted 1345
4 SASI_Hs01_00124640 predicted 1113
5 SASI_Hs01_00124642 predicted 1031
6 SASI_Hs01_00124643 predicted 1011
7 SASI_Hs01_00124644 predicted 1195
8 SASI_Hs02_00349150 predicted 388
9 SASI_Hs01_00124645 predicted 751
10 SASI_Hs02_00349151 predicted 1223
11 SASI_Hs01_00124637 predicted 616
12 SASI_Hs01_00124641 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105826 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212906 predicted 200
2 SASI_Rn02_00212907 predicted 429
3 SASI_Rn02_00212908 predicted 593
4 SASI_Rn02_00212909 predicted 301
5 SASI_Rn02_00212910 predicted 613
6 SASI_Rn02_00212911 predicted 289
7 SASI_Rn02_00212912 predicted 827
8 SASI_Rn02_00212913 predicted 344
9 SASI_Rn02_00212914 predicted 697
10 SASI_Rn02_00212915 predicted 205
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019756 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00140848 predicted 718
2 SASI_Mm01_00140849 predicted 774
3 SASI_Mm01_00140850 predicted 1033
4 SASI_Mm01_00140851 predicted 800
5 SASI_Mm01_00140852 predicted 613
6 SASI_Mm01_00140853 predicted 880
7 SASI_Mm01_00140854 predicted 1386
8 SASI_Mm01_00140855 predicted 484
9 SASI_Mm01_00140856 predicted 1017
10 SASI_Mm01_00140857 predicted 1526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016261
TUBD1 MISSION shRNA Bacterial Glycerol Stock
tubulin, delta 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000431204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016261.2-1090s21c1
Sequence:CCGGTGCTGAGTGTTCGTAACATTCCTCGAGGAATGTTACGAACACTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016261.2-1588s21c1
Sequence:CCGGTAGACAGTTTCACGTCATTAGCTCGAGCTAATGACGTGAAACTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016261.2-1983s21c1
Sequence:CCGGCGTAGAATGCTGAGTCTATTCCTCGAGGAATAGACTCAGCATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016261.2-2254s1c1
Sequence:CCGGCCAAACTTTCACAGCATAATTCTCGAGAATTATGCTGTGAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-615s1c1
Sequence:CCGGCCCAGGCATGAAGAATCTATACTCGAGTATAGATTCTTCATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-798s1c1
Sequence:CCGGCCTTATGGAACTGGTGAGGTTCTCGAGAACCTCACCAGTTCCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-732s1c1
Sequence:CCGGGCTTTCGTTACACAGAATTTACTCGAGTAAATTCTGTGTAACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000116374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-1184s1c1
Sequence:CCGGGCTCATTTCTAATGCAAAGATCTCGAGATCTTTGCATTAGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016261
TUBD1 MISSION shRNA shRNA Plasmid DNA
tubulin, delta 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000431204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016261.2-1090s21c1
Sequence:CCGGTGCTGAGTGTTCGTAACATTCCTCGAGGAATGTTACGAACACTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016261.2-1588s21c1
Sequence:CCGGTAGACAGTTTCACGTCATTAGCTCGAGCTAATGACGTGAAACTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016261.2-1983s21c1
Sequence:CCGGCGTAGAATGCTGAGTCTATTCCTCGAGGAATAGACTCAGCATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016261.2-2254s1c1
Sequence:CCGGCCAAACTTTCACAGCATAATTCTCGAGAATTATGCTGTGAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-615s1c1
Sequence:CCGGCCCAGGCATGAAGAATCTATACTCGAGTATAGATTCTTCATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-798s1c1
Sequence:CCGGCCTTATGGAACTGGTGAGGTTCTCGAGAACCTCACCAGTTCCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-732s1c1
Sequence:CCGGGCTTTCGTTACACAGAATTTACTCGAGTAAATTCTGTGTAACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000116374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-1184s1c1
Sequence:CCGGGCTCATTTCTAATGCAAAGATCTCGAGATCTTTGCATTAGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016261
TUBD1 MISSION shRNA Lentiviral Transduction Particles
tubulin, delta 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000431204    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016261.2-1090s21c1
Sequence:CCGGTGCTGAGTGTTCGTAACATTCCTCGAGGAATGTTACGAACACTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421746    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016261.2-1588s21c1
Sequence:CCGGTAGACAGTTTCACGTCATTAGCTCGAGCTAATGACGTGAAACTGTCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421070    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016261.2-1983s21c1
Sequence:CCGGCGTAGAATGCTGAGTCTATTCCTCGAGGAATAGACTCAGCATTCTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116372    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016261.2-2254s1c1
Sequence:CCGGCCAAACTTTCACAGCATAATTCTCGAGAATTATGCTGTGAAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116373    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-615s1c1
Sequence:CCGGCCCAGGCATGAAGAATCTATACTCGAGTATAGATTCTTCATGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116375    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-798s1c1
Sequence:CCGGCCTTATGGAACTGGTGAGGTTCTCGAGAACCTCACCAGTTCCATAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116376    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-732s1c1
Sequence:CCGGGCTTTCGTTACACAGAATTTACTCGAGTAAATTCTGTGTAACGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000116374    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016261.2-1184s1c1
Sequence:CCGGGCTCATTTCTAATGCAAAGATCTCGAGATCTTTGCATTAGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019756
VALIDATED
TUBD1 MISSION shRNA Bacterial Glycerol Stock
tubulin, delta 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000090098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-315s1c1
Sequence:CCGGGCTGTTCTTGTTGACATGGAACTCGAGTTCCATGTCAACAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-869s1c1
Sequence:CCGGCTCATTTCACTACCGCAGAAACTCGAGTTTCTGCGGTAGTGAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019756.1-441s1c1
Sequence:CCGGGCATACGGTTACTCTGTGCATCTCGAGATGCACAGAGTAACCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-868s1c1
Sequence:CCGGGCTCATTTCACTACCGCAGAACTCGAGTTCTGCGGTAGTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000090099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-1390s1c1
Sequence:CCGGCCTTTATCCATCAGTACACAACTCGAGTTGTGTACTGATGGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019756
VALIDATED
TUBD1 MISSION shRNA shRNA Plasmid DNA
tubulin, delta 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000090098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-315s1c1
Sequence:CCGGGCTGTTCTTGTTGACATGGAACTCGAGTTCCATGTCAACAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-869s1c1
Sequence:CCGGCTCATTTCACTACCGCAGAAACTCGAGTTTCTGCGGTAGTGAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019756.1-441s1c1
Sequence:CCGGGCATACGGTTACTCTGTGCATCTCGAGATGCACAGAGTAACCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-868s1c1
Sequence:CCGGGCTCATTTCACTACCGCAGAACTCGAGTTCTGCGGTAGTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000090099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-1390s1c1
Sequence:CCGGCCTTTATCCATCAGTACACAACTCGAGTTGTGTACTGATGGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019756
VALIDATED
TUBD1 MISSION shRNA Lentiviral Transduction Particles
tubulin, delta 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000090098    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-315s1c1
Sequence:CCGGGCTGTTCTTGTTGACATGGAACTCGAGTTCCATGTCAACAAGAACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090100    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-869s1c1
Sequence:CCGGCTCATTTCACTACCGCAGAAACTCGAGTTTCTGCGGTAGTGAAATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019756.1-441s1c1
Sequence:CCGGGCATACGGTTACTCTGTGCATCTCGAGATGCACAGAGTAACCGTATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090102    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-868s1c1
Sequence:CCGGGCTCATTTCACTACCGCAGAACTCGAGTTCTGCGGTAGTGAAATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000090099    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_019756.1-1390s1c1
Sequence:CCGGCCTTTATCCATCAGTACACAACTCGAGTTGTGTACTGATGGATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks