EMAIL THIS PAGE TO A FRIEND

TUBE1

tubulin, epsilon 1

Synonyms: TUBE dJ142L7.2
UniProtKB ID: Q9UJT0, Q5H8W8, Q8NEG3
Gene ID:
Human(51175) Summary: This gene encodes a member of the tubulin superfamily. This protein localizes to the centriolar sub-distal appendages that are associated with the older of the two centrioles after centrosome duplication. This protein plays a central role in organization of the microtubules during centriole duplication. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Jan 2009]
Mouse(71924) epsilon-tubulin 1
Rat(361856) tubulin, epsilon 1
domestic guinea pig(100727567) tubulin, epsilon 1
naked mole-rat(101696785) tubulin, epsilon 1
Domestic Rabbit(100340587) tubulin, epsilon 1
cow(512715) tubulin, epsilon 1
sheep(101108660) tubulin, epsilon 1
Zebrafish(393960) tubulin, epsilon 1
Horse(100072438) tubulin, epsilon 1
domestic cat(101085977) tubulin, epsilon 1
dog(612390) tubulin, epsilon 1
chicken(421750) tubulin, epsilon 1
Gene Class: Cytoskeleton
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028006 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028006 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028006 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016262 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016262 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016262 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016262 Rosetta Predictions human pricing
NM_001108536 Rosetta Predictions rat pricing
NM_028006 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016262 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00103408 predicted 532
2 SASI_Hs02_00349152 predicted 707
3 SASI_Hs01_00103409 predicted 1333
4 SASI_Hs02_00349153 predicted 802
5 SASI_Hs01_00103410 predicted 509
6 SASI_Hs01_00103411 predicted 1201
7 SASI_Hs01_00103412 predicted 834
8 SASI_Hs01_00103413 predicted 960
9 SASI_Hs01_00103414 predicted 1489
10 SASI_Hs02_00349154 predicted 226
11 SASI_Hs01_00103407 predicted 877
12 SASI_Hs01_00103415 predicted 608
13 SASI_Hs01_00103416 predicted 921
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108536 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00239609 predicted 1386
2 SASI_Rn02_00239610 predicted 1710
3 SASI_Rn02_00239611 predicted 901
4 SASI_Rn02_00239612 predicted 836
5 SASI_Rn02_00239613 predicted 865
6 SASI_Rn02_00239614 predicted 884
7 SASI_Rn02_00239615 predicted 1397
8 SASI_Rn02_00239616 predicted 1149
9 SASI_Rn02_00239617 predicted 781
10 SASI_Rn02_00239618 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028006 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157360 predicted 523
2 SASI_Mm01_00157361 predicted 536
3 SASI_Mm02_00333112 predicted 285
4 SASI_Mm01_00157362 predicted 587
5 SASI_Mm01_00157363 predicted 585
6 SASI_Mm02_00333113 predicted 1169
7 SASI_Mm02_00333114 predicted 360
8 SASI_Mm01_00157364 predicted 750
9 SASI_Mm01_00157365 predicted 572
10 SASI_Mm01_00157367 predicted 939
11 SASI_Mm01_00157366 predicted 881
12 SASI_Mm01_00157368 predicted 411
13 SASI_Mm01_00157369 predicted 526
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028006
TUBE1 MISSION shRNA Bacterial Glycerol Stock
tubulin, epsilon 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028006.1-1803s1c1
Sequence:CCGGCCTTGCTTTATTTGTGTCTTTCTCGAGAAAGACACAAATAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-1232s1c1
Sequence:CCGGACTCGCATTCTCTGTTAGCTTCTCGAGAAGCTAACAGAGAATGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-583s1c1
Sequence:CCGGGCGGTTTATCCTTCCAGTGAACTCGAGTTCACTGGAAGGATAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-903s1c1
Sequence:CCGGCCTGAATGAGATCAGCATGAACTCGAGTTCATGCTGATCTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-171s1c1
Sequence:CCGGCGACGCTATAAGCAGCTTCTTCTCGAGAAGAAGCTGCTTATAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028006
TUBE1 MISSION shRNA shRNA Plasmid DNA
tubulin, epsilon 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028006.1-1803s1c1
Sequence:CCGGCCTTGCTTTATTTGTGTCTTTCTCGAGAAAGACACAAATAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-1232s1c1
Sequence:CCGGACTCGCATTCTCTGTTAGCTTCTCGAGAAGCTAACAGAGAATGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-583s1c1
Sequence:CCGGGCGGTTTATCCTTCCAGTGAACTCGAGTTCACTGGAAGGATAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-903s1c1
Sequence:CCGGCCTGAATGAGATCAGCATGAACTCGAGTTCATGCTGATCTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-171s1c1
Sequence:CCGGCGACGCTATAAGCAGCTTCTTCTCGAGAAGAAGCTGCTTATAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028006
TUBE1 MISSION shRNA Lentiviral Transduction Particles
tubulin, epsilon 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091103    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028006.1-1803s1c1
Sequence:CCGGCCTTGCTTTATTTGTGTCTTTCTCGAGAAAGACACAAATAAAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091107    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-1232s1c1
Sequence:CCGGACTCGCATTCTCTGTTAGCTTCTCGAGAAGCTAACAGAGAATGCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091106    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-583s1c1
Sequence:CCGGGCGGTTTATCCTTCCAGTGAACTCGAGTTCACTGGAAGGATAAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091105    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-903s1c1
Sequence:CCGGCCTGAATGAGATCAGCATGAACTCGAGTTCATGCTGATCTCATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091104    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028006.1-171s1c1
Sequence:CCGGCGACGCTATAAGCAGCTTCTTCTCGAGAAGAAGCTGCTTATAGCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016262
VALIDATED
TUBE1 MISSION shRNA Bacterial Glycerol Stock
tubulin, epsilon 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000117062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016262.3-1724s1c1
Sequence:CCGGGCCTCATATTTAGGCATTTATCTCGAGATAAATGCCTAAATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-1238s1c1
Sequence:CCGGCCCACCTTCATGGAACTGAAACTCGAGTTTCAGTTCCATGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-107s1c1
Sequence:CCGGGCGGTCAACCAGAAAGGAATTCTCGAGAATTCCTTTCTGGTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-640s1c1
Sequence:CCGGGCCCATTGACAATCAATCTTTCTCGAGAAAGATTGATTGTCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016262.3-641s1c1
Sequence:CCGGCCCATTGACAATCAATCTTTACTCGAGTAAAGATTGATTGTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016262
VALIDATED
TUBE1 MISSION shRNA shRNA Plasmid DNA
tubulin, epsilon 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000117062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016262.3-1724s1c1
Sequence:CCGGGCCTCATATTTAGGCATTTATCTCGAGATAAATGCCTAAATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-1238s1c1
Sequence:CCGGCCCACCTTCATGGAACTGAAACTCGAGTTTCAGTTCCATGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-107s1c1
Sequence:CCGGGCGGTCAACCAGAAAGGAATTCTCGAGAATTCCTTTCTGGTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-640s1c1
Sequence:CCGGGCCCATTGACAATCAATCTTTCTCGAGAAAGATTGATTGTCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016262.3-641s1c1
Sequence:CCGGCCCATTGACAATCAATCTTTACTCGAGTAAAGATTGATTGTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016262
VALIDATED
TUBE1 MISSION shRNA Lentiviral Transduction Particles
tubulin, epsilon 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000117062    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016262.3-1724s1c1
Sequence:CCGGGCCTCATATTTAGGCATTTATCTCGAGATAAATGCCTAAATATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-1238s1c1
Sequence:CCGGCCCACCTTCATGGAACTGAAACTCGAGTTTCAGTTCCATGAAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-107s1c1
Sequence:CCGGGCGGTCAACCAGAAAGGAATTCTCGAGAATTCCTTTCTGGTTGACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_016262.3-640s1c1
Sequence:CCGGGCCCATTGACAATCAATCTTTCTCGAGAAAGATTGATTGTCAATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016262.3-641s1c1
Sequence:CCGGCCCATTGACAATCAATCTTTACTCGAGTAAAGATTGATTGTCAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks