EMAIL THIS PAGE TO A FRIEND

TUBG1

tubulin, gamma 1

Synonyms: GCP-1 TUBG TUBGCP1
UniProtKB ID: P23258, Q53X79, Q9BW59
Gene ID:
Human(7283) Summary: This gene encodes a member of the tubulin superfamily. The encoded protein localizes to the centrosome where it binds to microtubules as part of a complex referred to as the gamma-tubulin ring complex. The protein mediates microtubule nucleation and is required for microtubule formation and progression of the cell cycle. A pseudogene of this gene is found on chromosome 7. [provided by RefSeq, Jan 2009]
Mouse(103733) tubulin, gamma 1
Rat(252921) tubulin, gamma 1
Thale Cress(825338) tubulin gamma-1 chain
Zebrafish(393882) tubulin, gamma 1
chicken(420025) tubulin, gamma 1
domestic cat(101097283) tubulin, gamma 1
dog(403695) tubulin, gamma 1
cow(541101) tubulin, gamma 1
cow(786128) tubulin gamma-1 chain-like
sheep(101103906) tubulin, gamma 1
Goat(100861342) tubulin, gamma 1
naked mole-rat(101716093) tubulin, gamma 1
Gene Class: Cytoskeleton
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
T3320 Anti-γ-Tubulin (AK-15) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution frog, rat, human
immunocytochemistry, microarray, western blot pricing
T3195 Anti-γ-Tubulin (DQ-19) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, chicken
immunofluorescence, western blot pricing
T5192 Anti-γ-Tubulin antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, human
immunofluorescence, western blot pricing
T3559 Anti-γ-Tubulin antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution chicken, human
immunofluorescence, microarray, western blot pricing
C7604 Anti-γ-Tubulin-Cy3 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution chicken, human
immunofluorescence pricing
SAB2701850 Anti-tubg1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
western blot pricing
SAB2701676 Anti-tubg1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution zebrafish
immunofluorescence, immunohistochemistry, western blot pricing
HPA043012 Anti-TUBG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA046040 Anti-TUBG1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB4503045 Anti-Tubulin γ, C-Terminal antibody produced in rabbit affinity isolated antibody mouse, rat, human
immunohistochemistry, western blot pricing
T6557 Monoclonal Anti-γ-Tubulin antibody produced in mouse clone GTU-88, ascites fluid Xenopus, canine, chicken, hamster, human, rat, bovine, mouse
ELISA, immunocytochemistry, western blot pricing
T5326 Monoclonal Anti-γ-Tubulin antibody produced in mouse clone GTU-88, purified from hybridoma cell culture Xenopus, canine, chicken, hamster, human, rat, bovine, mouse
ELISA, immunocytochemistry, immunoprecipitation, microarray, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_134024 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134024 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134024 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001070 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU094601 MISSION® esiRNA esiRNA targeting mouse Tubg1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001070 Rosetta Predictions human pricing
NM_145778 Rosetta Predictions rat pricing
NM_134024 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00311882 predicted 595
2 SASI_Hs01_00232846 predicted 556
3 SASI_Hs01_00232847 predicted 1229
4 SASI_Hs01_00232849 predicted 440
5 SASI_Hs01_00232853 predicted 1221
6 SASI_Hs02_00311883 predicted 607
7 SASI_Hs02_00311884 predicted 542
8 SASI_Hs02_00311885 predicted 529
9 SASI_Hs02_00311886 predicted 1220
10 SASI_Hs02_00311887 predicted 1566
11 SASI_Hs01_00232845 predicted 1008
12 SASI_Hs01_00232848 predicted 1186
13 SASI_Hs01_00232850 predicted 567
14 SASI_Hs01_00232851 predicted 1284
15 SASI_Hs01_00232852 predicted 465
16 SASI_Hs01_00232854 predicted 381
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145778 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064805 predicted 425
2 SASI_Rn01_00064806 predicted 494
3 SASI_Rn01_00064808 predicted 1387
4 SASI_Rn01_00064811 predicted 558
5 SASI_Rn02_00268781 predicted 1286
6 SASI_Rn01_00064802 predicted 1378
7 SASI_Rn02_00268782 predicted 1597
8 SASI_Rn02_00268783 predicted 1608
9 SASI_Rn02_00268784 predicted 1604
10 SASI_Rn02_00268785 predicted 1614
11 SASI_Rn01_00064803 predicted 498
12 SASI_Rn01_00064804 predicted 1056
13 SASI_Rn01_00064807 predicted 1139
14 SASI_Rn01_00064809 predicted 873
15 SASI_Rn01_00064810 predicted 902
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134024 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00183856 predicted 1332
2 SASI_Mm01_00183857 predicted 374
3 SASI_Mm01_00183858 predicted 510
4 SASI_Mm01_00183859 predicted 507
5 SASI_Mm01_00183860 predicted 433
6 SASI_Mm01_00183861 predicted 1225
7 SASI_Mm01_00183865 predicted 68
8 SASI_Mm02_00339184 predicted 1487
9 SASI_Mm02_00339185 predicted 1437
10 SASI_Mm02_00339186 predicted 1239
11 SASI_Mm01_00183862 predicted 460
12 SASI_Mm01_00183863 predicted 457
13 SASI_Mm01_00183864 predicted 66
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134024
VALIDATED
TUBG1 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134024.1-104s1c1
Sequence:CCGGGCAATCAGATTGGGTTCGAGTCTCGAGACTCGAACCCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134024.1-1347s1c1
Sequence:CCGGGCAGCAGCTGATTGACGAGTACTCGAGTACTCGTCAATCAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-104s21c1
Sequence:CCGGGCAATCAGATTGGGTTCGAGTCTCGAGACTCGAACCCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-517s21c1
Sequence:CCGGTACCTCCTGGAACGGCTAAATCTCGAGATTTAGCCGTTCCAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1439s21c1
Sequence:CCGGCTCATCTGCCTTACCGGTTAGCTCGAGCTAACCGGTAAGGCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000332302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1347s21c1
Sequence:CCGGGCAGCAGCTGATTGACGAGTACTCGAGTACTCGTCAATCAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1244s21c1
Sequence:CCGGAGTTTGACAAGCTGCGGAAACCTCGAGGTTTCCGCAGCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134024
VALIDATED
TUBG1 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134024.1-104s1c1
Sequence:CCGGGCAATCAGATTGGGTTCGAGTCTCGAGACTCGAACCCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134024.1-1347s1c1
Sequence:CCGGGCAGCAGCTGATTGACGAGTACTCGAGTACTCGTCAATCAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-104s21c1
Sequence:CCGGGCAATCAGATTGGGTTCGAGTCTCGAGACTCGAACCCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-517s21c1
Sequence:CCGGTACCTCCTGGAACGGCTAAATCTCGAGATTTAGCCGTTCCAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1439s21c1
Sequence:CCGGCTCATCTGCCTTACCGGTTAGCTCGAGCTAACCGGTAAGGCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000332302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1347s21c1
Sequence:CCGGGCAGCAGCTGATTGACGAGTACTCGAGTACTCGTCAATCAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1244s21c1
Sequence:CCGGAGTTTGACAAGCTGCGGAAACCTCGAGGTTTCCGCAGCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134024
VALIDATED
TUBG1 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089905    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134024.1-104s1c1
Sequence:CCGGGCAATCAGATTGGGTTCGAGTCTCGAGACTCGAACCCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089907    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134024.1-1347s1c1
Sequence:CCGGGCAGCAGCTGATTGACGAGTACTCGAGTACTCGTCAATCAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-104s21c1
Sequence:CCGGGCAATCAGATTGGGTTCGAGTCTCGAGACTCGAACCCAATCTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-517s21c1
Sequence:CCGGTACCTCCTGGAACGGCTAAATCTCGAGATTTAGCCGTTCCAGGAGGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306377    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1439s21c1
Sequence:CCGGCTCATCTGCCTTACCGGTTAGCTCGAGCTAACCGGTAAGGCAGATGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000332302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1347s21c1
Sequence:CCGGGCAGCAGCTGATTGACGAGTACTCGAGTACTCGTCAATCAGCTGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306433    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_134024.2-1244s21c1
Sequence:CCGGAGTTTGACAAGCTGCGGAAACCTCGAGGTTTCCGCAGCTTGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001070
VALIDATED
TUBG1 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000072388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001070.3-1241s1c1
Sequence:CCGGCCAGTATGACAAGCTGCGTAACTCGAGTTACGCAGCTTGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-530s1c1
Sequence:CCGGGCTGAATGACAGGTATCCTAACTCGAGTTAGGATACCTGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-515s1c1
Sequence:CCGGCTACCTCTTAGAACGGCTGAACTCGAGTTCAGCCGTTCTAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-507s1c1
Sequence:CCGGCTGGGTTCCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGGAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000072392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001070.3-1226s1c1
Sequence:CCGGCGAGAGAACCTGTCGCCAGTACTCGAGTACTGGCGACAGGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-940s21c1
Sequence:CCGGTGGTGGTCCAGCCTTACAATTCTCGAGAATTGTAAGGCTGGACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-843s21c1
Sequence:CCGGCTGGGTTCCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGGAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-1562s21c1
Sequence:CCGGCGAGAGAACCTGTCGCCAGTACTCGAGTACTGGCGACAGGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-866s21c1
Sequence:CCGGGCTGAATGACAGGTATCCTAACTCGAGTTAGGATACCTGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001070.4-1773s21c1
Sequence:CCGGCCTCATCTGCCTTACTGGTTGCTCGAGCAACCAGTAAGGCAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001070
VALIDATED
TUBG1 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000072388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001070.3-1241s1c1
Sequence:CCGGCCAGTATGACAAGCTGCGTAACTCGAGTTACGCAGCTTGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-530s1c1
Sequence:CCGGGCTGAATGACAGGTATCCTAACTCGAGTTAGGATACCTGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-515s1c1
Sequence:CCGGCTACCTCTTAGAACGGCTGAACTCGAGTTCAGCCGTTCTAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-507s1c1
Sequence:CCGGCTGGGTTCCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGGAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000072392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001070.3-1226s1c1
Sequence:CCGGCGAGAGAACCTGTCGCCAGTACTCGAGTACTGGCGACAGGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-940s21c1
Sequence:CCGGTGGTGGTCCAGCCTTACAATTCTCGAGAATTGTAAGGCTGGACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-843s21c1
Sequence:CCGGCTGGGTTCCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGGAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-1562s21c1
Sequence:CCGGCGAGAGAACCTGTCGCCAGTACTCGAGTACTGGCGACAGGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-866s21c1
Sequence:CCGGGCTGAATGACAGGTATCCTAACTCGAGTTAGGATACCTGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001070.4-1773s21c1
Sequence:CCGGCCTCATCTGCCTTACTGGTTGCTCGAGCAACCAGTAAGGCAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001070
VALIDATED
TUBG1 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000072388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001070.3-1241s1c1
Sequence:CCGGCCAGTATGACAAGCTGCGTAACTCGAGTTACGCAGCTTGTCATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-530s1c1
Sequence:CCGGGCTGAATGACAGGTATCCTAACTCGAGTTAGGATACCTGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-515s1c1
Sequence:CCGGCTACCTCTTAGAACGGCTGAACTCGAGTTCAGCCGTTCTAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_001070.3-507s1c1
Sequence:CCGGCTGGGTTCCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGGAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000072392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001070.3-1226s1c1
Sequence:CCGGCGAGAGAACCTGTCGCCAGTACTCGAGTACTGGCGACAGGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-940s21c1
Sequence:CCGGTGGTGGTCCAGCCTTACAATTCTCGAGAATTGTAAGGCTGGACCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-843s21c1
Sequence:CCGGCTGGGTTCCTACCTCTTAGAACTCGAGTTCTAAGAGGTAGGAACCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286426    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-1562s21c1
Sequence:CCGGCGAGAGAACCTGTCGCCAGTACTCGAGTACTGGCGACAGGTTCTCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286424    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001070.4-866s21c1
Sequence:CCGGGCTGAATGACAGGTATCCTAACTCGAGTTAGGATACCTGTCATTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293806    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001070.4-1773s21c1
Sequence:CCGGCCTCATCTGCCTTACTGGTTGCTCGAGCAACCAGTAAGGCAGATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks