EMAIL THIS PAGE TO A FRIEND

TUBG2

tubulin, gamma 2

UniProtKB ID: Q9NRH3, A6NDI4, Q32NB2
Gene ID:
Mouse(103768) tubulin, gamma 2
Rat(680991) tubulin, gamma 2
dog(490962) tubulin, gamma 2
domestic cat(101099090) tubulin, gamma 2
naked mole-rat(101715754) tubulin, gamma 2
cow(540216) tubulin, gamma 2
sheep(101111036) tubulin, gamma 2
73 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016437 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016437 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016437 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134028 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134028 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134028 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016437 Rosetta Predictions human pricing
XM_001059827 Rosetta Predictions rat pricing
NM_134028 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016437 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00154999 predicted 784
2 SASI_Hs02_00349465 predicted 1392
3 SASI_Hs01_00155002 predicted 788
4 SASI_Hs01_00155003 predicted 797
5 SASI_Hs01_00155004 predicted 739
6 SASI_Hs02_00349466 predicted 619
7 SASI_Hs01_00155006 predicted 1509
8 SASI_Hs01_00155007 predicted 631
9 SASI_Hs01_00155008 predicted 591
10 SASI_Hs02_00349467 predicted 691
11 SASI_Hs01_00155000 predicted 297
12 SASI_Hs01_00155001 predicted 1201
13 SASI_Hs01_00155005 predicted 848
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059827 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294479 predicted 423
2 SASI_Rn02_00294480 predicted 559
3 SASI_Rn02_00294481 predicted 554
4 SASI_Rn02_00294482 predicted 514
5 SASI_Rn02_00294483 predicted 431
6 SASI_Rn02_00294484 predicted 622
7 SASI_Rn02_00294485 predicted 373
8 SASI_Rn02_00294486 predicted 429
9 SASI_Rn02_00294487 predicted 413
10 SASI_Rn02_00294488 predicted 450
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134028 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162587 predicted 709
2 SASI_Mm01_00162588 predicted 718
3 SASI_Mm01_00162589 predicted 1371
4 SASI_Mm01_00162590 predicted 643
5 SASI_Mm01_00162591 predicted 530
6 SASI_Mm01_00162592 predicted 278
7 SASI_Mm01_00162593 predicted 608
8 SASI_Mm01_00162594 predicted 575
9 SASI_Mm01_00162595 predicted 583
10 SASI_Mm01_00162596 predicted 1628
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016437
TUBG2 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-808s21c1
Sequence:CCGGGCCCTACAATTCACTCCTGACCTCGAGGTCAGGAGTGAATTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-922s21c1
Sequence:CCGGCCCGTCCTTCTCCCAGATCAACTCGAGTTGATCTGGGAGAAGGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-629s21c1
Sequence:CCGGGAAGCAGATGGAAGTGACAGTCTCGAGACTGTCACTTCCATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-1510s21c1
Sequence:CCGGTGATGAGATGGACAGGTCTAGCTCGAGCTAGACCTGTCCATCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016437.2-1647s21c1
Sequence:CCGGGTAACCACAGCCTCGACCATGCTCGAGCATGGTCGAGGCTGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-740s21c1
Sequence:CCGGCCCAAGAAGCTAGTGCAGACTCTCGAGAGTCTGCACTAGCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016437.1-1615s1c1
Sequence:CCGGCCACTACTCCTTCTCCTTCTACTCGAGTAGAAGGAGAAGGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-1413s1c1
Sequence:CCGGTGAAAGTTCCTGCCAGCAGTTCTCGAGAACTGCTGGCAGGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-741s1c1
Sequence:CCGGGCTAGTGCAGACTTATTCAGTCTCGAGACTGAATAAGTCTGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-1403s1c1
Sequence:CCGGCCTCGCTCTTTGAAAGTTCCTCTCGAGAGGAACTTTCAAAGAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000117173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-790s1c1
Sequence:CCGGGTAGTGGTTCAGCCCTACAATCTCGAGATTGTAGGGCTGAACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016437
TUBG2 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-808s21c1
Sequence:CCGGGCCCTACAATTCACTCCTGACCTCGAGGTCAGGAGTGAATTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-922s21c1
Sequence:CCGGCCCGTCCTTCTCCCAGATCAACTCGAGTTGATCTGGGAGAAGGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-629s21c1
Sequence:CCGGGAAGCAGATGGAAGTGACAGTCTCGAGACTGTCACTTCCATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-1510s21c1
Sequence:CCGGTGATGAGATGGACAGGTCTAGCTCGAGCTAGACCTGTCCATCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016437.2-1647s21c1
Sequence:CCGGGTAACCACAGCCTCGACCATGCTCGAGCATGGTCGAGGCTGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-740s21c1
Sequence:CCGGCCCAAGAAGCTAGTGCAGACTCTCGAGAGTCTGCACTAGCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016437.1-1615s1c1
Sequence:CCGGCCACTACTCCTTCTCCTTCTACTCGAGTAGAAGGAGAAGGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-1413s1c1
Sequence:CCGGTGAAAGTTCCTGCCAGCAGTTCTCGAGAACTGCTGGCAGGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-741s1c1
Sequence:CCGGGCTAGTGCAGACTTATTCAGTCTCGAGACTGAATAAGTCTGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-1403s1c1
Sequence:CCGGCCTCGCTCTTTGAAAGTTCCTCTCGAGAGGAACTTTCAAAGAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000117173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-790s1c1
Sequence:CCGGGTAGTGGTTCAGCCCTACAATCTCGAGATTGTAGGGCTGAACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016437
TUBG2 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444458    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-808s21c1
Sequence:CCGGGCCCTACAATTCACTCCTGACCTCGAGGTCAGGAGTGAATTGTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415986    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-922s21c1
Sequence:CCGGCCCGTCCTTCTCCCAGATCAACTCGAGTTGATCTGGGAGAAGGACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-629s21c1
Sequence:CCGGGAAGCAGATGGAAGTGACAGTCTCGAGACTGTCACTTCCATCTGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-1510s21c1
Sequence:CCGGTGATGAGATGGACAGGTCTAGCTCGAGCTAGACCTGTCCATCTCATCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436760    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016437.2-1647s21c1
Sequence:CCGGGTAACCACAGCCTCGACCATGCTCGAGCATGGTCGAGGCTGTGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016437.2-740s21c1
Sequence:CCGGCCCAAGAAGCTAGTGCAGACTCTCGAGAGTCTGCACTAGCTTCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117172    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016437.1-1615s1c1
Sequence:CCGGCCACTACTCCTTCTCCTTCTACTCGAGTAGAAGGAGAAGGAGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-1413s1c1
Sequence:CCGGTGAAAGTTCCTGCCAGCAGTTCTCGAGAACTGCTGGCAGGAACTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-741s1c1
Sequence:CCGGGCTAGTGCAGACTTATTCAGTCTCGAGACTGAATAAGTCTGCACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-1403s1c1
Sequence:CCGGCCTCGCTCTTTGAAAGTTCCTCTCGAGAGGAACTTTCAAAGAGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000117173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016437.1-790s1c1
Sequence:CCGGGTAGTGGTTCAGCCCTACAATCTCGAGATTGTAGGGCTGAACCACTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134028
TUBG2 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134028.1-1621s1c1
Sequence:CCGGCCAGACCCTCTGACCCAACTTCTCGAGAAGTTGGGTCAGAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-739s1c1
Sequence:CCGGCAGGACGAGATGAGTGATGTACTCGAGTACATCACTCATCTCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-574s1c1
Sequence:CCGGGACATTATAGACCGAGAAGCACTCGAGTGCTTCTCGGTCTATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-669s1c1
Sequence:CCGGCTACCTCTTAGAGCGACTGAACTCGAGTTCAGTCGCTCTAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-1500s1c1
Sequence:CCGGGCAGGAACTCATTGACGAGTACTCGAGTACTCGTCAATGAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134028
TUBG2 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134028.1-1621s1c1
Sequence:CCGGCCAGACCCTCTGACCCAACTTCTCGAGAAGTTGGGTCAGAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-739s1c1
Sequence:CCGGCAGGACGAGATGAGTGATGTACTCGAGTACATCACTCATCTCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-574s1c1
Sequence:CCGGGACATTATAGACCGAGAAGCACTCGAGTGCTTCTCGGTCTATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-669s1c1
Sequence:CCGGCTACCTCTTAGAGCGACTGAACTCGAGTTCAGTCGCTCTAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-1500s1c1
Sequence:CCGGGCAGGAACTCATTGACGAGTACTCGAGTACTCGTCAATGAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134028
TUBG2 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089793    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_134028.1-1621s1c1
Sequence:CCGGCCAGACCCTCTGACCCAACTTCTCGAGAAGTTGGGTCAGAGGGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-739s1c1
Sequence:CCGGCAGGACGAGATGAGTGATGTACTCGAGTACATCACTCATCTCGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-574s1c1
Sequence:CCGGGACATTATAGACCGAGAAGCACTCGAGTGCTTCTCGGTCTATAATGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-669s1c1
Sequence:CCGGCTACCTCTTAGAGCGACTGAACTCGAGTTCAGTCGCTCTAAGAGGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134028.1-1500s1c1
Sequence:CCGGGCAGGAACTCATTGACGAGTACTCGAGTACTCGTCAATGAGTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks