EMAIL THIS PAGE TO A FRIEND

TUBGCP2

tubulin, gamma complex associated protein 2

Synonyms: GCP-2 GCP2 Grip103 SPBC97 Spc97p h103p hGCP2 hSpc97
Gene ID:
Mouse(74237) tubulin, gamma complex associated protein 2
Rat(309098) tubulin, gamma complex associated protein 2
cow(781376) tubulin, gamma complex associated protein 2
sheep(101113640) tubulin, gamma complex associated protein 2
naked mole-rat(101700229) tubulin, gamma complex associated protein 2
Domestic Rabbit(100342827) tubulin, gamma complex associated protein 2
domestic guinea pig(100729044) tubulin, gamma complex associated protein 2
Zebrafish(386975) tubulin, gamma complex associated protein 2
chicken(423673) tubulin, gamma complex associated protein 2
domestic cat(101083549) tubulin, gamma complex associated protein 2
dog(480829) tubulin, gamma complex associated protein 2
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_133755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006659 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006659 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006659 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006659 Rosetta Predictions human pricing
NM_001107560 Rosetta Predictions rat pricing
NM_133755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006659 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00167235 predicted 356
2 SASI_Hs01_00167236 predicted 1570
3 SASI_Hs02_00342043 predicted 1929
4 SASI_Hs01_00167237 predicted 2417
5 SASI_Hs01_00167238 predicted 528
6 SASI_Hs01_00167239 predicted 1826
7 SASI_Hs01_00167240 predicted 2873
8 SASI_Hs01_00167241 predicted 2411
9 SASI_Hs01_00167243 predicted 1188
10 SASI_Hs01_00167244 predicted 1800
11 SASI_Hs01_00167242 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230035 predicted 299
2 SASI_Rn02_00230036 predicted 1276
3 SASI_Rn02_00230037 predicted 2597
4 SASI_Rn02_00230038 predicted 1766
5 SASI_Rn02_00230039 predicted 2534
6 SASI_Rn02_00230040 predicted 2555
7 SASI_Rn02_00230041 predicted 1489
8 SASI_Rn02_00230042 predicted 1903
9 SASI_Rn02_00230043 predicted 223
10 SASI_Rn02_00230044 predicted 2299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00104049 predicted 1950
2 SASI_Mm01_00104050 predicted 225
3 SASI_Mm01_00104051 predicted 2721
4 SASI_Mm01_00104052 predicted 1642
5 SASI_Mm02_00338741 predicted 2475
6 SASI_Mm01_00104054 predicted 1107
7 SASI_Mm01_00104056 predicted 2094
8 SASI_Mm01_00104057 predicted 2495
9 SASI_Mm01_00104058 predicted 2389
10 SASI_Mm02_00338742 predicted 2349
11 SASI_Mm01_00104053 predicted 2677
12 SASI_Mm01_00104055 predicted 410
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133755
TUBGCP2 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-1630s1c1
Sequence:CCGGGTAGCCAAAGAAATCATCTATCTCGAGATAGATGATTTCTTTGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-595s1c1
Sequence:CCGGGCCTCTAAGATGTCCACACAACTCGAGTTGTGTGGACATCTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-2798s1c1
Sequence:CCGGCCAGACTAGATTTCAATGGTTCTCGAGAACCATTGAAATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-1690s1c1
Sequence:CCGGGCGTTCAATTATGCCAGCAAACTCGAGTTTGCTGGCATAATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-2505s1c1
Sequence:CCGGGCAGAAATTTACACAGAGTATCTCGAGATACTCTGTGTAAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133755
TUBGCP2 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-1630s1c1
Sequence:CCGGGTAGCCAAAGAAATCATCTATCTCGAGATAGATGATTTCTTTGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-595s1c1
Sequence:CCGGGCCTCTAAGATGTCCACACAACTCGAGTTGTGTGGACATCTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-2798s1c1
Sequence:CCGGCCAGACTAGATTTCAATGGTTCTCGAGAACCATTGAAATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-1690s1c1
Sequence:CCGGGCGTTCAATTATGCCAGCAAACTCGAGTTTGCTGGCATAATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-2505s1c1
Sequence:CCGGGCAGAAATTTACACAGAGTATCTCGAGATACTCTGTGTAAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133755
TUBGCP2 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120805    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-1630s1c1
Sequence:CCGGGTAGCCAAAGAAATCATCTATCTCGAGATAGATGATTTCTTTGGCTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120803    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-595s1c1
Sequence:CCGGGCCTCTAAGATGTCCACACAACTCGAGTTGTGTGGACATCTTAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120804    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-2798s1c1
Sequence:CCGGCCAGACTAGATTTCAATGGTTCTCGAGAACCATTGAAATCTAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120802    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-1690s1c1
Sequence:CCGGGCGTTCAATTATGCCAGCAAACTCGAGTTTGCTGGCATAATTGAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120806    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133755.1-2505s1c1
Sequence:CCGGGCAGAAATTTACACAGAGTATCTCGAGATACTCTGTGTAAATTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006659
VALIDATED
TUBGCP2 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006659.1-2121s1c1
Sequence:CCGGGCTCAACTTCGTCCAGAATATCTCGAGATATTCTGGACGAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-1521s1c1
Sequence:CCGGGCAGATCGAGAAGGCGTTTAACTCGAGTTAAACGCCTTCTCGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-514s1c1
Sequence:CCGGCAGCAGTCTCTGGAACTTAAACTCGAGTTTAAGTTCCAGAGACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006659.1-1472s1c1
Sequence:CCGGCGGTGGCTAAAGAGATCATCTCTCGAGAGATGATCTCTTTAGCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-2633s1c1
Sequence:CCGGCCAGGCTTGACTTCAATGGTTCTCGAGAACCATTGAAGTCAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-1638s1c1
Sequence:CCGGCGACTTCTTCGTGCACTTCATCTCGAGATGAAGTGCACGAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-1320s1c1
Sequence:CCGGCCAGGAGGATTACAACGACAACTCGAGTTGTCGTTGTAATCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006659.1-513s1c1
Sequence:CCGGGCAGCAGTCTCTGGAACTTAACTCGAGTTAAGTTCCAGAGACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-303s1c1
Sequence:CCGGGCTGGTGTACCTGTTGTCAAACTCGAGTTTGACAACAGGTACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-236s1c1
Sequence:CCGGGTACTCCAGAAGACTTTCTAACTCGAGTTAGAAAGTCTTCTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-2637s1c1
Sequence:CCGGGCTTGACTTCAATGGTTTCTACTCGAGTAGAAACCATTGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006659
VALIDATED
TUBGCP2 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006659.1-2121s1c1
Sequence:CCGGGCTCAACTTCGTCCAGAATATCTCGAGATATTCTGGACGAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-1521s1c1
Sequence:CCGGGCAGATCGAGAAGGCGTTTAACTCGAGTTAAACGCCTTCTCGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-514s1c1
Sequence:CCGGCAGCAGTCTCTGGAACTTAAACTCGAGTTTAAGTTCCAGAGACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006659.1-1472s1c1
Sequence:CCGGCGGTGGCTAAAGAGATCATCTCTCGAGAGATGATCTCTTTAGCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-2633s1c1
Sequence:CCGGCCAGGCTTGACTTCAATGGTTCTCGAGAACCATTGAAGTCAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-1638s1c1
Sequence:CCGGCGACTTCTTCGTGCACTTCATCTCGAGATGAAGTGCACGAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-1320s1c1
Sequence:CCGGCCAGGAGGATTACAACGACAACTCGAGTTGTCGTTGTAATCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006659.1-513s1c1
Sequence:CCGGGCAGCAGTCTCTGGAACTTAACTCGAGTTAAGTTCCAGAGACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-303s1c1
Sequence:CCGGGCTGGTGTACCTGTTGTCAAACTCGAGTTTGACAACAGGTACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-236s1c1
Sequence:CCGGGTACTCCAGAAGACTTTCTAACTCGAGTTAGAAAGTCTTCTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-2637s1c1
Sequence:CCGGGCTTGACTTCAATGGTTTCTACTCGAGTAGAAACCATTGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006659
VALIDATED
TUBGCP2 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006659.1-2121s1c1
Sequence:CCGGGCTCAACTTCGTCCAGAATATCTCGAGATATTCTGGACGAAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140130    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-1521s1c1
Sequence:CCGGGCAGATCGAGAAGGCGTTTAACTCGAGTTAAACGCCTTCTCGATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140959    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-514s1c1
Sequence:CCGGCAGCAGTCTCTGGAACTTAAACTCGAGTTTAAGTTCCAGAGACTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139220    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006659.1-1472s1c1
Sequence:CCGGCGGTGGCTAAAGAGATCATCTCTCGAGAGATGATCTCTTTAGCCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139329    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-2633s1c1
Sequence:CCGGCCAGGCTTGACTTCAATGGTTCTCGAGAACCATTGAAGTCAAGCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139403    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-1638s1c1
Sequence:CCGGCGACTTCTTCGTGCACTTCATCTCGAGATGAAGTGCACGAAGAAGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139732    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-1320s1c1
Sequence:CCGGCCAGGAGGATTACAACGACAACTCGAGTTGTCGTTGTAATCCTCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140549    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006659.1-513s1c1
Sequence:CCGGGCAGCAGTCTCTGGAACTTAACTCGAGTTAAGTTCCAGAGACTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-303s1c1
Sequence:CCGGGCTGGTGTACCTGTTGTCAAACTCGAGTTTGACAACAGGTACACCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145109    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006659.1-236s1c1
Sequence:CCGGGTACTCCAGAAGACTTTCTAACTCGAGTTAGAAAGTCTTCTGGAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_006659.1-2637s1c1
Sequence:CCGGGCTTGACTTCAATGGTTTCTACTCGAGTAGAAACCATTGAAGTCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks