EMAIL THIS PAGE TO A FRIEND

TUBGCP3

tubulin, gamma complex associated protein 3

Synonyms: GCP3 SPBC98 Spc98p
Gene ID:
Mouse(259279) tubulin, gamma complex associated protein 3
Rat(306599) tubulin, gamma complex associated protein 3
Zebrafish(563517) tubulin, gamma complex associated protein 3
chicken(418750) tubulin, gamma complex associated protein 3
Horse(100066840) tubulin, gamma complex associated protein 3
domestic cat(101097537) tubulin, gamma complex associated protein 3
dog(476991) tubulin, gamma complex associated protein 3
domestic guinea pig(100717502) tubulin, gamma complex associated protein 3
Domestic Rabbit(100328661) tubulin, gamma complex associated protein 3
naked mole-rat(101712208) tubulin, gamma complex associated protein 3
cow(526529) tubulin, gamma complex associated protein 3
sheep(101117598) tubulin, gamma complex associated protein 3
Gene Class: Cytoskeleton
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006322 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198031 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198031 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198031 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006322 Rosetta Predictions human pricing
NM_001107323 Rosetta Predictions rat pricing
NM_198031 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134521 predicted 2131
2 SASI_Hs01_00134523 predicted 2364
3 SASI_Hs01_00134524 predicted 2737
4 SASI_Hs01_00134525 predicted 364
5 SASI_Hs02_00341346 predicted 361
6 SASI_Hs01_00134527 predicted 1889
7 SASI_Hs01_00134528 predicted 1693
8 SASI_Hs02_00341347 predicted 1963
9 SASI_Hs02_00341348 predicted 2012
10 SASI_Hs02_00341349 predicted 2401
11 SASI_Hs01_00134519 predicted 2125
12 SASI_Hs01_00134520 predicted 1196
13 SASI_Hs01_00134522 predicted 2171
14 SASI_Hs01_00134526 predicted 2209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227705 predicted 1520
2 SASI_Rn02_00227706 predicted 238
3 SASI_Rn02_00227707 predicted 1304
4 SASI_Rn02_00227708 predicted 1963
5 SASI_Rn02_00227709 predicted 1088
6 SASI_Rn02_00227710 predicted 1007
7 SASI_Rn02_00227711 predicted 1614
8 SASI_Rn02_00227712 predicted 308
9 SASI_Rn02_00227713 predicted 396
10 SASI_Rn02_00227714 predicted 200
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198031 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00025859 predicted 1522
2 SASI_Mm01_00025860 predicted 1116
3 SASI_Mm01_00025861 predicted 1100
4 SASI_Mm01_00025862 predicted 246
5 SASI_Mm01_00025863 predicted 1007
6 SASI_Mm01_00025864 predicted 1812
7 SASI_Mm01_00025866 predicted 1431
8 SASI_Mm01_00025867 predicted 1307
9 SASI_Mm01_00025868 predicted 1821
10 SASI_Mm02_00350780 predicted 2689
11 SASI_Mm01_00025865 predicted 822
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006322
VALIDATED
TUBGCP3 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-3709s1c1
Sequence:CCGGCGACATGGATAATGAAGATTTCTCGAGAAATCTTCATTATCCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006322.3-2161s1c1
Sequence:CCGGGCCACTACCTAAGAGTATTTACTCGAGTAAATACTCTTAGGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-798s1c1
Sequence:CCGGGCATGGACTTTAACTGCAAATCTCGAGATTTGCAGTTAAAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-904s1c1
Sequence:CCGGCGGGTGGTACTATGGAAATTACTCGAGTAATTTCCATAGTACCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006322.3-2258s1c1
Sequence:CCGGCCTGAGAAACATGCCAGAGTTCTCGAGAACTCTGGCATGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006322.4-1472s21c1
Sequence:CCGGTTCCTGTACCGCTGGATATATCTCGAGATATATCCAGCGGTACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000429682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006322.4-2951s21c1
Sequence:CCGGTGCACTGCTAGACACGAAATTCTCGAGAATTTCGTGTCTAGCAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006322
VALIDATED
TUBGCP3 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-3709s1c1
Sequence:CCGGCGACATGGATAATGAAGATTTCTCGAGAAATCTTCATTATCCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006322.3-2161s1c1
Sequence:CCGGGCCACTACCTAAGAGTATTTACTCGAGTAAATACTCTTAGGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-798s1c1
Sequence:CCGGGCATGGACTTTAACTGCAAATCTCGAGATTTGCAGTTAAAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-904s1c1
Sequence:CCGGCGGGTGGTACTATGGAAATTACTCGAGTAATTTCCATAGTACCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006322.3-2258s1c1
Sequence:CCGGCCTGAGAAACATGCCAGAGTTCTCGAGAACTCTGGCATGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006322.4-1472s21c1
Sequence:CCGGTTCCTGTACCGCTGGATATATCTCGAGATATATCCAGCGGTACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000429682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006322.4-2951s21c1
Sequence:CCGGTGCACTGCTAGACACGAAATTCTCGAGAATTTCGTGTCTAGCAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006322
VALIDATED
TUBGCP3 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108335    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-3709s1c1
Sequence:CCGGCGACATGGATAATGAAGATTTCTCGAGAAATCTTCATTATCCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108338    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006322.3-2161s1c1
Sequence:CCGGGCCACTACCTAAGAGTATTTACTCGAGTAAATACTCTTAGGTAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108339    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-798s1c1
Sequence:CCGGGCATGGACTTTAACTGCAAATCTCGAGATTTGCAGTTAAAGTCCATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_006322.3-904s1c1
Sequence:CCGGCGGGTGGTACTATGGAAATTACTCGAGTAATTTCCATAGTACCACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006322.3-2258s1c1
Sequence:CCGGCCTGAGAAACATGCCAGAGTTCTCGAGAACTCTGGCATGTTTCTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431039    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006322.4-1472s21c1
Sequence:CCGGTTCCTGTACCGCTGGATATATCTCGAGATATATCCAGCGGTACAGGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000429682    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006322.4-2951s21c1
Sequence:CCGGTGCACTGCTAGACACGAAATTCTCGAGAATTTCGTGTCTAGCAGTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198031
TUBGCP3 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000091978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198031.1-3116s1c1
Sequence:CCGGGCATTCTCTGTGAGACAGTTTCTCGAGAAACTGTCTCACAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-2393s1c1
Sequence:CCGGGCCGTGTTTGACCAAATCATTCTCGAGAATGATTTGGTCAAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-806s1c1
Sequence:CCGGGCTGCTCTTGTGAGAGATATTCTCGAGAATATCTCTCACAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-2038s1c1
Sequence:CCGGCCACTACCTGAGAGTGTTTAACTCGAGTTAAACACTCTCAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000091980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-1382s1c1
Sequence:CCGGGAGGACACTTACCACGAATTTCTCGAGAAATTCGTGGTAAGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-995s21c1
Sequence:CCGGAGGAGTCTGGACCGCTCATTTCTCGAGAAATGAGCGGTCCAGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-1437s21c1
Sequence:CCGGGTCTATGGCACGACAAGTATACTCGAGTATACTTGTCGTGCCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-1612s21c1
Sequence:CCGGCCGTGACGCTGCGGATTTATTCTCGAGAATAAATCCGCAGCGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198031
TUBGCP3 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000091978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198031.1-3116s1c1
Sequence:CCGGGCATTCTCTGTGAGACAGTTTCTCGAGAAACTGTCTCACAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-2393s1c1
Sequence:CCGGGCCGTGTTTGACCAAATCATTCTCGAGAATGATTTGGTCAAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-806s1c1
Sequence:CCGGGCTGCTCTTGTGAGAGATATTCTCGAGAATATCTCTCACAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-2038s1c1
Sequence:CCGGCCACTACCTGAGAGTGTTTAACTCGAGTTAAACACTCTCAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000091980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-1382s1c1
Sequence:CCGGGAGGACACTTACCACGAATTTCTCGAGAAATTCGTGGTAAGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-995s21c1
Sequence:CCGGAGGAGTCTGGACCGCTCATTTCTCGAGAAATGAGCGGTCCAGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-1437s21c1
Sequence:CCGGGTCTATGGCACGACAAGTATACTCGAGTATACTTGTCGTGCCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-1612s21c1
Sequence:CCGGCCGTGACGCTGCGGATTTATTCTCGAGAATAAATCCGCAGCGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198031
TUBGCP3 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000091978    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198031.1-3116s1c1
Sequence:CCGGGCATTCTCTGTGAGACAGTTTCTCGAGAAACTGTCTCACAGAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-2393s1c1
Sequence:CCGGGCCGTGTTTGACCAAATCATTCTCGAGAATGATTTGGTCAAACACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091981    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-806s1c1
Sequence:CCGGGCTGCTCTTGTGAGAGATATTCTCGAGAATATCTCTCACAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091982    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-2038s1c1
Sequence:CCGGCCACTACCTGAGAGTGTTTAACTCGAGTTAAACACTCTCAGGTAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000091980    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198031.1-1382s1c1
Sequence:CCGGGAGGACACTTACCACGAATTTCTCGAGAAATTCGTGGTAAGTGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435606    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-995s21c1
Sequence:CCGGAGGAGTCTGGACCGCTCATTTCTCGAGAAATGAGCGGTCCAGACTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-1437s21c1
Sequence:CCGGGTCTATGGCACGACAAGTATACTCGAGTATACTTGTCGTGCCATAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434508    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198031.1-1612s21c1
Sequence:CCGGCCGTGACGCTGCGGATTTATTCTCGAGAATAAATCCGCAGCGTCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks