EMAIL THIS PAGE TO A FRIEND

TUBGCP4

tubulin, gamma complex associated protein 4

Synonyms: 76P GCP-4 GCP4 h76p hGCP4 hGrip76
UniProtKB ID: Q9UGJ1, B3KNK6, Q969X3, Q9NVF0
Gene ID:
Mouse(51885) tubulin, gamma complex associated protein 4
Rat(362203) tubulin, gamma complex associated protein 4
cow(510865) tubulin, gamma complex associated protein 4
sheep(101107391) tubulin, gamma complex associated protein 4
naked mole-rat(101719324) tubulin, gamma complex associated protein 4
Domestic Rabbit(100328679) tubulin, gamma complex associated protein 4
domestic guinea pig(100717299) tubulin, gamma complex associated protein 4
Zebrafish(557155) tubulin, gamma complex associated protein 4
Horse(100056364) tubulin, gamma complex associated protein 4
domestic cat(101099128) tubulin, gamma complex associated protein 4
dog(478273) tubulin, gamma complex associated protein 4
chicken(415590) tubulin, gamma complex associated protein 4
Gene Class: Cytoskeleton
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153387 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153387 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153387 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014444 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014444 Rosetta Predictions human pricing
XM_001076537 Rosetta Predictions rat pricing
XM_342504 Rosetta Predictions rat pricing
NM_153387 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014444 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135744 predicted 829
2 SASI_Hs01_00135747 predicted 478
3 SASI_Hs02_00345651 predicted 1416
4 SASI_Hs01_00135748 predicted 1606
5 SASI_Hs01_00135749 predicted 1510
6 SASI_Hs01_00135750 predicted 1396
7 SASI_Hs01_00135751 predicted 635
8 SASI_Hs01_00135752 predicted 1474
9 SASI_Hs02_00345652 predicted 863
10 SASI_Hs01_00135753 predicted 591
11 SASI_Hs01_00135745 predicted 706
12 SASI_Hs01_00135746 predicted 1826
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076537 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353614 predicted 925
2 SASI_Rn02_00353615 predicted 613
3 SASI_Rn02_00353616 predicted 371
4 SASI_Rn02_00353617 predicted 1032
5 SASI_Rn02_00353618 predicted 1788
6 SASI_Rn02_00353619 predicted 549
7 SASI_Rn02_00353620 predicted 1384
8 SASI_Rn02_00353621 predicted 731
9 SASI_Rn02_00353622 predicted 316
10 SASI_Rn02_00353623 predicted 550
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342504 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00170459 predicted 633
2 SASI_Rn01_00170460 predicted 1233
3 SASI_Rn01_00170461 predicted 601
4 SASI_Rn01_00170462 predicted 1775
5 SASI_Rn01_00170463 predicted 539
6 SASI_Rn01_00170464 predicted 1388
7 SASI_Rn01_00170465 predicted 713
8 SASI_Rn01_00170466 predicted 304
9 SASI_Rn01_00170467 predicted 434
10 SASI_Rn01_00170468 predicted 1070
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153387 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00080219 predicted 776
2 SASI_Mm02_00343150 predicted 909
3 SASI_Mm01_00080221 predicted 590
4 SASI_Mm02_00343151 predicted 2022
5 SASI_Mm01_00080222 predicted 1222
6 SASI_Mm01_00080223 predicted 532
7 SASI_Mm01_00080224 predicted 1772
8 SASI_Mm02_00343152 predicted 1247
9 SASI_Mm02_00343153 predicted 1396
10 SASI_Mm01_00080227 predicted 1420
11 SASI_Mm01_00080220 predicted 2292
12 SASI_Mm01_00080225 predicted 2252
13 SASI_Mm01_00080226 predicted 1943
14 SASI_Mm01_00080228 predicted 308
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153387
TUBGCP4 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 4
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153387.2-488s21c1
Sequence:CCGGTCGCCAAGCACTGCTTGATTTCTCGAGAAATCAAGCAGTGCTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153387.2-1240s21c1
Sequence:CCGGTGGGTCAGCTGAAGATCATTACTCGAGTAATGATCTTCAGCTGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153387.1-2229s1c1
Sequence:CCGGGCCACATTCTGATGTCTGTAACTCGAGTTACAGACATCAGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-357s1c1
Sequence:CCGGCTGAGTTCATTGAACAGTATACTCGAGTATACTGTTCAATGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-914s1c1
Sequence:CCGGCGCCTAATTGAGGAAGAGAATCTCGAGATTCTCTTCCTCAATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-1388s1c1
Sequence:CCGGGCACACAAGGTGTTGCTAGATCTCGAGATCTAGCAACACCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-1922s1c1
Sequence:CCGGCCTGTGTTTCACTGCCTGAATCTCGAGATTCAGGCAGTGAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153387
TUBGCP4 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 4
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153387.2-488s21c1
Sequence:CCGGTCGCCAAGCACTGCTTGATTTCTCGAGAAATCAAGCAGTGCTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153387.2-1240s21c1
Sequence:CCGGTGGGTCAGCTGAAGATCATTACTCGAGTAATGATCTTCAGCTGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153387.1-2229s1c1
Sequence:CCGGGCCACATTCTGATGTCTGTAACTCGAGTTACAGACATCAGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-357s1c1
Sequence:CCGGCTGAGTTCATTGAACAGTATACTCGAGTATACTGTTCAATGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-914s1c1
Sequence:CCGGCGCCTAATTGAGGAAGAGAATCTCGAGATTCTCTTCCTCAATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-1388s1c1
Sequence:CCGGGCACACAAGGTGTTGCTAGATCTCGAGATCTAGCAACACCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-1922s1c1
Sequence:CCGGCCTGTGTTTCACTGCCTGAATCTCGAGATTCAGGCAGTGAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153387
TUBGCP4 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 4
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444411    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153387.2-488s21c1
Sequence:CCGGTCGCCAAGCACTGCTTGATTTCTCGAGAAATCAAGCAGTGCTTGGCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430785    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153387.2-1240s21c1
Sequence:CCGGTGGGTCAGCTGAAGATCATTACTCGAGTAATGATCTTCAGCTGACCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120807    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_153387.1-2229s1c1
Sequence:CCGGGCCACATTCTGATGTCTGTAACTCGAGTTACAGACATCAGAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-357s1c1
Sequence:CCGGCTGAGTTCATTGAACAGTATACTCGAGTATACTGTTCAATGAACTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120808    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-914s1c1
Sequence:CCGGCGCCTAATTGAGGAAGAGAATCTCGAGATTCTCTTCCTCAATTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120810    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-1388s1c1
Sequence:CCGGGCACACAAGGTGTTGCTAGATCTCGAGATCTAGCAACACCTTGTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120809    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153387.1-1922s1c1
Sequence:CCGGCCTGTGTTTCACTGCCTGAATCTCGAGATTCAGGCAGTGAAACACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014444
TUBGCP4 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000158304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1930s1c1
Sequence:CCGGCTGAGCAATTTGCTGGCTCAACTCGAGTTGAGCCAGCAAATTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1783s1c1
Sequence:CCGGCGCCTAAGAAATCACATGGCACTCGAGTGCCATGTGATTTCTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2656s1c1
Sequence:CCGGGCTGGATGTTACCACCAAGTACTCGAGTACTTGGTGGTAACATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-2100s1c1
Sequence:CCGGCCAGTCTTCACTCCTGTTCAACTCGAGTTGAACAGGAGTGAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-640s1c1
Sequence:CCGGCCCTCTGTGATGGTTGTAGTACTCGAGTACTACAACCATCACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2279s1c1
Sequence:CCGGCCCAAGGTTGTAACAGAAGATCTCGAGATCTTCTGTTACAACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014444.2-2167s1c1
Sequence:CCGGCAACTACTGTTACGACTAGATCTCGAGATCTAGTCGTAACAGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1441s1c1
Sequence:CCGGCACAAGGTATTGCTAGATGATCTCGAGATCATCTAGCAATACCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1269s1c1
Sequence:CCGGGATGGTAGAAGAATCCGATTTCTCGAGAAATCGGATTCTTCTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2280s1c1
Sequence:CCGGCCAAGGTTGTAACAGAAGATTCTCGAGAATCTTCTGTTACAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1784s1c1
Sequence:CCGGGCCTAAGAAATCACATGGCATCTCGAGATGCCATGTGATTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-400s1c1
Sequence:CCGGCGCTTCACTGAGTTCATTGAACTCGAGTTCAATGAACTCAGTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014444.2-2164s1c1
Sequence:CCGGGCTCAACTACTGTTACGACTACTCGAGTAGTCGTAACAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014444
TUBGCP4 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000158304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1930s1c1
Sequence:CCGGCTGAGCAATTTGCTGGCTCAACTCGAGTTGAGCCAGCAAATTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1783s1c1
Sequence:CCGGCGCCTAAGAAATCACATGGCACTCGAGTGCCATGTGATTTCTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2656s1c1
Sequence:CCGGGCTGGATGTTACCACCAAGTACTCGAGTACTTGGTGGTAACATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-2100s1c1
Sequence:CCGGCCAGTCTTCACTCCTGTTCAACTCGAGTTGAACAGGAGTGAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-640s1c1
Sequence:CCGGCCCTCTGTGATGGTTGTAGTACTCGAGTACTACAACCATCACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2279s1c1
Sequence:CCGGCCCAAGGTTGTAACAGAAGATCTCGAGATCTTCTGTTACAACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014444.2-2167s1c1
Sequence:CCGGCAACTACTGTTACGACTAGATCTCGAGATCTAGTCGTAACAGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1441s1c1
Sequence:CCGGCACAAGGTATTGCTAGATGATCTCGAGATCATCTAGCAATACCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1269s1c1
Sequence:CCGGGATGGTAGAAGAATCCGATTTCTCGAGAAATCGGATTCTTCTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2280s1c1
Sequence:CCGGCCAAGGTTGTAACAGAAGATTCTCGAGAATCTTCTGTTACAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1784s1c1
Sequence:CCGGGCCTAAGAAATCACATGGCATCTCGAGATGCCATGTGATTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-400s1c1
Sequence:CCGGCGCTTCACTGAGTTCATTGAACTCGAGTTCAATGAACTCAGTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014444.2-2164s1c1
Sequence:CCGGGCTCAACTACTGTTACGACTACTCGAGTAGTCGTAACAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014444
TUBGCP4 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000158304    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1930s1c1
Sequence:CCGGCTGAGCAATTTGCTGGCTCAACTCGAGTTGAGCCAGCAAATTGCTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1783s1c1
Sequence:CCGGCGCCTAAGAAATCACATGGCACTCGAGTGCCATGTGATTTCTTAGGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157605    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2656s1c1
Sequence:CCGGGCTGGATGTTACCACCAAGTACTCGAGTACTTGGTGGTAACATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-2100s1c1
Sequence:CCGGCCAGTCTTCACTCCTGTTCAACTCGAGTTGAACAGGAGTGAAGACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156413    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-640s1c1
Sequence:CCGGCCCTCTGTGATGGTTGTAGTACTCGAGTACTACAACCATCACAGAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153921    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2279s1c1
Sequence:CCGGCCCAAGGTTGTAACAGAAGATCTCGAGATCTTCTGTTACAACCTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152309    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014444.2-2167s1c1
Sequence:CCGGCAACTACTGTTACGACTAGATCTCGAGATCTAGTCGTAACAGTAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1441s1c1
Sequence:CCGGCACAAGGTATTGCTAGATGATCTCGAGATCATCTAGCAATACCTTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150609    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1269s1c1
Sequence:CCGGGATGGTAGAAGAATCCGATTTCTCGAGAAATCGGATTCTTCTACCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152135    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014444.2-2280s1c1
Sequence:CCGGCCAAGGTTGTAACAGAAGATTCTCGAGAATCTTCTGTTACAACCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152497    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-1784s1c1
Sequence:CCGGGCCTAAGAAATCACATGGCATCTCGAGATGCCATGTGATTTCTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153922    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014444.2-400s1c1
Sequence:CCGGCGCTTCACTGAGTTCATTGAACTCGAGTTCAATGAACTCAGTGAAGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014444.2-2164s1c1
Sequence:CCGGGCTCAACTACTGTTACGACTACTCGAGTAGTCGTAACAGTAGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks