EMAIL THIS PAGE TO A FRIEND

TUBGCP5

tubulin, gamma complex associated protein 5

Synonyms: GCP5
UniProtKB ID: Q96RT8, E9PB12, Q6IQ52, Q96PY8
Gene ID:
Mouse(233276) tubulin, gamma complex associated protein 5
Rat(308663) tubulin, gamma complex associated protein 5
Zebrafish(553191) tubulin, gamma complex associated protein 5
dog(478999) tubulin, gamma complex associated protein 5
Horse(100147272) tubulin, gamma complex associated protein 5
domestic cat(101090247) tubulin, gamma complex associated protein 5
chicken(100858683) tubulin, gamma complex associated protein 5
domestic guinea pig(100730775) tubulin, gamma complex associated protein 5
Domestic Rabbit(100339583) tubulin, gamma complex associated protein 5
naked mole-rat(101723976) tubulin, gamma complex associated protein 5
cow(512912) tubulin, gamma complex associated protein 5
sheep(101103700) tubulin, gamma complex associated protein 5
Gene Class: Cytoskeleton
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052903 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146190 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146190 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146190 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102610 Rosetta Predictions human pricing
NM_052903 Rosetta Predictions human pricing
NM_001107516 Rosetta Predictions rat pricing
NM_146190 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102610 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323409 predicted 2133
2 SASI_Hs02_00323410 predicted 649
3 SASI_Hs02_00323411 predicted 914
4 SASI_Hs02_00323412 predicted 230
5 SASI_Hs02_00323413 predicted 2686
6 SASI_Hs02_00323414 predicted 2108
7 SASI_Hs02_00323415 predicted 2713
8 SASI_Hs02_00323416 predicted 1981
9 SASI_Hs02_00323417 predicted 2487
10 SASI_Hs02_00323418 predicted 888
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052903 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00072190 predicted 2139
2 SASI_Hs01_00072191 predicted 652
3 SASI_Hs01_00072192 predicted 917
4 SASI_Hs02_00361649 predicted 231
5 SASI_Hs01_00072195 predicted 2682
6 SASI_Hs02_00361650 predicted 2109
7 SASI_Hs01_00072196 predicted 2715
8 SASI_Hs01_00072197 predicted 1982
9 SASI_Hs01_00072198 predicted 2490
10 SASI_Hs02_00361651 predicted 892
11 SASI_Hs01_00072193 predicted 2886
12 SASI_Hs01_00072194 predicted 2902
13 SASI_Hs01_00072199 predicted 980
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107516 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00229595 predicted 2317
2 SASI_Rn02_00229596 predicted 2970
3 SASI_Rn02_00229597 predicted 1783
4 SASI_Rn02_00229598 predicted 2780
5 SASI_Rn02_00229599 predicted 1941
6 SASI_Rn02_00229600 predicted 300
7 SASI_Rn02_00229601 predicted 372
8 SASI_Rn02_00229602 predicted 1382
9 SASI_Rn02_00229603 predicted 1065
10 SASI_Rn02_00229604 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146190 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00197190 predicted 2718
2 SASI_Mm01_00197191 predicted 2246
3 SASI_Mm01_00197193 predicted 283
4 SASI_Mm01_00197194 predicted 1061
5 SASI_Mm01_00197195 predicted 1314
6 SASI_Mm01_00197197 predicted 1722
7 SASI_Mm01_00197198 predicted 1185
8 SASI_Mm02_00341886 predicted 315
9 SASI_Mm01_00197199 predicted 1363
10 SASI_Mm02_00341887 predicted 1841
11 SASI_Mm01_00197192 predicted 2976
12 SASI_Mm01_00197196 predicted 2759
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052903
VALIDATED
TUBGCP5 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 5
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052903.1-993s1c1
Sequence:CCGGGCTGGAACAAATAGCAGCATACTCGAGTATGCTGCTATTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052903.1-2477s1c1
Sequence:CCGGCCGTGGACATTGTTATAAGTTCTCGAGAACTTATAACAATGTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052903.1-2677s1c1
Sequence:CCGGCCAGTAAGACAGCAGATTCATCTCGAGATGAATCTGCTGTCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052903.1-740s1c1
Sequence:CCGGCCTCCCAGTTTCCTCATAGTTCTCGAGAACTATGAGGAAACTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-1656s21c1
Sequence:CCGGATGCAACTTACACGTTATATACTCGAGTATATAACGTGTAAGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-946s21c1
Sequence:CCGGGGAAACCCTATGGTTACTTTCCTCGAGGAAAGTAACCATAGGGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-924s21c1
Sequence:CCGGTTACTGAGACTCAGGTTATTCCTCGAGGAATAACCTGAGTCTCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-2887s21c1
Sequence:CCGGAGCCAAGGATTTAGATCAATTCTCGAGAATTGATCTAAATCCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-235s21c1
Sequence:CCGGCAACTTCCAGCTCGCCCTAAACTCGAGTTTAGGGCGAGCTGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-1277s21c1
Sequence:CCGGGAGAAGTGCATCATCAATAATCTCGAGATTATTGATGATGCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052903
VALIDATED
TUBGCP5 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 5
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052903.1-993s1c1
Sequence:CCGGGCTGGAACAAATAGCAGCATACTCGAGTATGCTGCTATTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052903.1-2477s1c1
Sequence:CCGGCCGTGGACATTGTTATAAGTTCTCGAGAACTTATAACAATGTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052903.1-2677s1c1
Sequence:CCGGCCAGTAAGACAGCAGATTCATCTCGAGATGAATCTGCTGTCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052903.1-740s1c1
Sequence:CCGGCCTCCCAGTTTCCTCATAGTTCTCGAGAACTATGAGGAAACTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-1656s21c1
Sequence:CCGGATGCAACTTACACGTTATATACTCGAGTATATAACGTGTAAGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-946s21c1
Sequence:CCGGGGAAACCCTATGGTTACTTTCCTCGAGGAAAGTAACCATAGGGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-924s21c1
Sequence:CCGGTTACTGAGACTCAGGTTATTCCTCGAGGAATAACCTGAGTCTCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-2887s21c1
Sequence:CCGGAGCCAAGGATTTAGATCAATTCTCGAGAATTGATCTAAATCCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-235s21c1
Sequence:CCGGCAACTTCCAGCTCGCCCTAAACTCGAGTTTAGGGCGAGCTGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-1277s21c1
Sequence:CCGGGAGAAGTGCATCATCAATAATCTCGAGATTATTGATGATGCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052903
VALIDATED
TUBGCP5 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 5
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149012    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052903.1-993s1c1
Sequence:CCGGGCTGGAACAAATAGCAGCATACTCGAGTATGCTGCTATTTGTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052903.1-2477s1c1
Sequence:CCGGCCGTGGACATTGTTATAAGTTCTCGAGAACTTATAACAATGTCCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148599    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052903.1-2677s1c1
Sequence:CCGGCCAGTAAGACAGCAGATTCATCTCGAGATGAATCTGCTGTCTTACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_052903.1-740s1c1
Sequence:CCGGCCTCCCAGTTTCCTCATAGTTCTCGAGAACTATGAGGAAACTGGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-1656s21c1
Sequence:CCGGATGCAACTTACACGTTATATACTCGAGTATATAACGTGTAAGTTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434338    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-946s21c1
Sequence:CCGGGGAAACCCTATGGTTACTTTCCTCGAGGAAAGTAACCATAGGGTTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413223    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-924s21c1
Sequence:CCGGTTACTGAGACTCAGGTTATTCCTCGAGGAATAACCTGAGTCTCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417341    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-2887s21c1
Sequence:CCGGAGCCAAGGATTTAGATCAATTCTCGAGAATTGATCTAAATCCTTGGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422248    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-235s21c1
Sequence:CCGGCAACTTCCAGCTCGCCCTAAACTCGAGTTTAGGGCGAGCTGGAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425881    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052903.4-1277s21c1
Sequence:CCGGGAGAAGTGCATCATCAATAATCTCGAGATTATTGATGATGCACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146190
TUBGCP5 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000115486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146190.2-3187s1c1
Sequence:CCGGGCTGAGAAATAAGAATCTGTTCTCGAGAACAGATTCTTATTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-2152s1c1
Sequence:CCGGGCTGTGGGAATCTCATGCAAACTCGAGTTTGCATGAGATTCCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-1718s1c1
Sequence:CCGGGCAGATCATAATGGCTGGCAACTCGAGTTGCCAGCCATTATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-986s1c1
Sequence:CCGGGCTGGAACAAATAGCAGCGTACTCGAGTACGCTGCTATTTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000115487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-2929s1c1
Sequence:CCGGCGCTCATGTTTGCAGAAGGTTCTCGAGAACCTTCTGCAAACATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-2360s21c1
Sequence:CCGGTGAAGACAGTTTACGTTTATCCTCGAGGATAAACGTAAACTGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-1256s21c1
Sequence:CCGGACCTCGATTGGCGCAGCTAAACTCGAGTTTAGCTGCGCCAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-1906s21c1
Sequence:CCGGCAACCAAAGAGAACCTTATAACTCGAGTTATAAGGTTCTCTTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146190.2-3276s21c1
Sequence:CCGGTTATCGAGTATGTAGAGTTATCTCGAGATAACTCTACATACTCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000353395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-754s21c1
Sequence:CCGGCACATCTGCACTCCAATTTAGCTCGAGCTAAATTGGAGTGCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146190
TUBGCP5 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000115486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146190.2-3187s1c1
Sequence:CCGGGCTGAGAAATAAGAATCTGTTCTCGAGAACAGATTCTTATTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-2152s1c1
Sequence:CCGGGCTGTGGGAATCTCATGCAAACTCGAGTTTGCATGAGATTCCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-1718s1c1
Sequence:CCGGGCAGATCATAATGGCTGGCAACTCGAGTTGCCAGCCATTATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-986s1c1
Sequence:CCGGGCTGGAACAAATAGCAGCGTACTCGAGTACGCTGCTATTTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000115487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-2929s1c1
Sequence:CCGGCGCTCATGTTTGCAGAAGGTTCTCGAGAACCTTCTGCAAACATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-2360s21c1
Sequence:CCGGTGAAGACAGTTTACGTTTATCCTCGAGGATAAACGTAAACTGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-1256s21c1
Sequence:CCGGACCTCGATTGGCGCAGCTAAACTCGAGTTTAGCTGCGCCAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-1906s21c1
Sequence:CCGGCAACCAAAGAGAACCTTATAACTCGAGTTATAAGGTTCTCTTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146190.2-3276s21c1
Sequence:CCGGTTATCGAGTATGTAGAGTTATCTCGAGATAACTCTACATACTCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000353395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-754s21c1
Sequence:CCGGCACATCTGCACTCCAATTTAGCTCGAGCTAAATTGGAGTGCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146190
TUBGCP5 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000115486    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_146190.2-3187s1c1
Sequence:CCGGGCTGAGAAATAAGAATCTGTTCTCGAGAACAGATTCTTATTTCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115489    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-2152s1c1
Sequence:CCGGGCTGTGGGAATCTCATGCAAACTCGAGTTTGCATGAGATTCCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115490    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-1718s1c1
Sequence:CCGGGCAGATCATAATGGCTGGCAACTCGAGTTGCCAGCCATTATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115488    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-986s1c1
Sequence:CCGGGCTGGAACAAATAGCAGCGTACTCGAGTACGCTGCTATTTGTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000115487    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146190.2-2929s1c1
Sequence:CCGGCGCTCATGTTTGCAGAAGGTTCTCGAGAACCTTCTGCAAACATGAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336376    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-2360s21c1
Sequence:CCGGTGAAGACAGTTTACGTTTATCCTCGAGGATAAACGTAAACTGTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336375    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-1256s21c1
Sequence:CCGGACCTCGATTGGCGCAGCTAAACTCGAGTTTAGCTGCGCCAATCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336425    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-1906s21c1
Sequence:CCGGCAACCAAAGAGAACCTTATAACTCGAGTTATAAGGTTCTCTTTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336424    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146190.2-3276s21c1
Sequence:CCGGTTATCGAGTATGTAGAGTTATCTCGAGATAACTCTACATACTCGATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000353395    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146190.2-754s21c1
Sequence:CCGGCACATCTGCACTCCAATTTAGCTCGAGCTAAATTGGAGTGCAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks