EMAIL THIS PAGE TO A FRIEND

TUBGCP6

tubulin, gamma complex associated protein 6

Synonyms: GCP-6 GCP6 MCCRP MCPHCR
Gene ID:
Human(85378) Summary: The protein encoded by this gene is part of a large multisubunit complex required for microtubule nucleation at the centrosome. [provided by RefSeq, Jul 2008]
Mouse(328580) tubulin, gamma complex associated protein 6
Rat(362980) tubulin, gamma complex associated protein 6
cow(618908) tubulin, gamma complex associated protein 6
sheep(101115451) tubulin, gamma complex associated protein 6
naked mole-rat(101708516) tubulin, gamma complex associated protein 6
domestic guinea pig(100725515) tubulin, gamma complex associated protein 6
Zebrafish(100329494) tubulin, gamma complex associated protein 6
domestic cat(101080645) tubulin, gamma complex associated protein 6
dog(481193) tubulin, gamma complex associated protein 6
chicken(417743) tubulin, gamma complex associated protein 6
Gene Class: Cytoskeleton
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020461 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU208121 MISSION® esiRNA esiRNA targeting mouse Tubgcp6 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001008658 Rosetta Predictions human pricing
NM_020461 Rosetta Predictions human pricing
NM_001108748 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178327 predicted 3037
2 SASI_Hs01_00178328 predicted 2284
3 SASI_Hs01_00178329 predicted 618
4 SASI_Hs01_00178330 predicted 2157
5 SASI_Hs01_00178331 predicted 1096
6 SASI_Hs01_00178332 predicted 879
7 SASI_Hs01_00178333 predicted 906
8 SASI_Hs01_00178334 predicted 2313
9 SASI_Hs01_00178335 predicted 1721
10 SASI_Hs01_00178336 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00010967 predicted 1012
2 SASI_Hs01_00010968 predicted 702
3 SASI_Hs01_00010969 predicted 2271
4 SASI_Hs01_00010970 predicted 619
5 SASI_Hs01_00010971 predicted 1282
6 SASI_Hs01_00010972 predicted 2147
7 SASI_Hs02_00353517 predicted 3357
8 SASI_Hs01_00010973 predicted 1092
9 SASI_Hs01_00010975 predicted 4993
10 SASI_Hs02_00353518 predicted 5723
11 SASI_Hs01_00010966 predicted 669
12 SASI_Hs01_00010974 predicted 3035
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108748 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241695 predicted 3137
2 SASI_Rn02_00241696 predicted 727
3 SASI_Rn02_00241697 predicted 499
4 SASI_Rn02_00241698 predicted 4075
5 SASI_Rn02_00241699 predicted 1822
6 SASI_Rn02_00241700 predicted 497
7 SASI_Rn02_00241701 predicted 2801
8 SASI_Rn02_00241702 predicted 424
9 SASI_Rn02_00241703 predicted 1928
10 SASI_Rn02_00241704 predicted 2160
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020461
TUBGCP6 MISSION shRNA Bacterial Glycerol Stock
tubulin, gamma complex associated protein 6
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-3352s21c1
Sequence:CCGGGGCCACAGGAGTACGACTTTACTCGAGTAAAGTCGTACTCCTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2189s21c1
Sequence:CCGGGTACCTCAGCTTCCGAGATAACTCGAGTTATCTCGGAAGCTGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2301s21c1
Sequence:CCGGGTCTGCGGAAAGACCATTAACCTCGAGGTTAATGGTCTTTCCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2279s21c1
Sequence:CCGGGCACATTGCCCACGACATATACTCGAGTATATGTCGTGGGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-941s21c1
Sequence:CCGGTCCGTACAGCGGCTATGATTGCTCGAGCAATCATAGCCGCTGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020461.2-303s1c1
Sequence:CCGGGAGAAACAAGATCCTCATGTTCTCGAGAACATGAGGATCTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020461.2-2224s1c1
Sequence:CCGGCAGAGGCTGAAAGAACAATTTCTCGAGAAATTGTTCTTTCAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020461
TUBGCP6 MISSION shRNA shRNA Plasmid DNA
tubulin, gamma complex associated protein 6
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-3352s21c1
Sequence:CCGGGGCCACAGGAGTACGACTTTACTCGAGTAAAGTCGTACTCCTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2189s21c1
Sequence:CCGGGTACCTCAGCTTCCGAGATAACTCGAGTTATCTCGGAAGCTGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2301s21c1
Sequence:CCGGGTCTGCGGAAAGACCATTAACCTCGAGGTTAATGGTCTTTCCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2279s21c1
Sequence:CCGGGCACATTGCCCACGACATATACTCGAGTATATGTCGTGGGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-941s21c1
Sequence:CCGGTCCGTACAGCGGCTATGATTGCTCGAGCAATCATAGCCGCTGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020461.2-303s1c1
Sequence:CCGGGAGAAACAAGATCCTCATGTTCTCGAGAACATGAGGATCTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020461.2-2224s1c1
Sequence:CCGGCAGAGGCTGAAAGAACAATTTCTCGAGAAATTGTTCTTTCAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020461
TUBGCP6 MISSION shRNA Lentiviral Transduction Particles
tubulin, gamma complex associated protein 6
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257064    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-3352s21c1
Sequence:CCGGGGCCACAGGAGTACGACTTTACTCGAGTAAAGTCGTACTCCTGTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2189s21c1
Sequence:CCGGGTACCTCAGCTTCCGAGATAACTCGAGTTATCTCGGAAGCTGAGGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2301s21c1
Sequence:CCGGGTCTGCGGAAAGACCATTAACCTCGAGGTTAATGGTCTTTCCGCAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245418    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-2279s21c1
Sequence:CCGGGCACATTGCCCACGACATATACTCGAGTATATGTCGTGGGCAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244817    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020461.3-941s21c1
Sequence:CCGGTCCGTACAGCGGCTATGATTGCTCGAGCAATCATAGCCGCTGTACGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148057    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020461.2-303s1c1
Sequence:CCGGGAGAAACAAGATCCTCATGTTCTCGAGAACATGAGGATCTTGTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147163    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020461.2-2224s1c1
Sequence:CCGGCAGAGGCTGAAAGAACAATTTCTCGAGAAATTGTTCTTTCAGCCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks