EMAIL THIS PAGE TO A FRIEND

TUFM

Tu translation elongation factor, mitochondrial

Synonyms: COXPD4 EF-TuMT EFTU P43
UniProtKB ID: P49411, O15276
Gene ID:
Human(7284) Summary: This gene encodes a protein which participates in protein translation in mitochondria. Mutations in this gene have been associated with combined oxidative phosphorylation deficiency resulting in lactic acidosis and fatal encephalopathy. A pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2008]
Mouse(233870) Tu translation elongation factor, mitochondrial
Rat(293481) Tu translation elongation factor, mitochondrial
Zebrafish(541378) Tu translation elongation factor, mitochondrial
domestic cat(101090667) Tu translation elongation factor, mitochondrial
dog(479796) Tu translation elongation factor, mitochondrial
chicken(430889) Tu translation elongation factor, mitochondrial
domestic guinea pig(100727064) Tu translation elongation factor, mitochondrial
naked mole-rat(101717230) Tu translation elongation factor, mitochondrial
cow(281556) Tu translation elongation factor, mitochondrial
sheep(101121740) Tu translation elongation factor, mitochondrial
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003321 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003321 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003321 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172745 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172745 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172745 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003321 Rosetta Predictions human pricing
NM_001106295 Rosetta Predictions rat pricing
NM_172745 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003321 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00218571 predicted 528
2 SASI_Hs01_00218573 predicted 1045
3 SASI_Hs01_00218574 predicted 381
4 SASI_Hs02_00335457 predicted 1663
5 SASI_Hs01_00218575 predicted 1058
6 SASI_Hs02_00335458 predicted 1516
7 SASI_Hs01_00218576 predicted 300
8 SASI_Hs01_00218577 predicted 1296
9 SASI_Hs01_00218579 predicted 1019
10 SASI_Hs01_00218580 predicted 478
11 SASI_Hs01_00218572 predicted 447
12 SASI_Hs01_00218578 predicted 223
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106295 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00217568 predicted 1254
2 SASI_Rn02_00217569 predicted 1352
3 SASI_Rn02_00217570 predicted 596
4 SASI_Rn02_00217571 predicted 702
5 SASI_Rn02_00217572 predicted 864
6 SASI_Rn02_00217573 predicted 1605
7 SASI_Rn02_00217574 predicted 1549
8 SASI_Rn02_00217575 predicted 1440
9 SASI_Rn02_00217576 predicted 1455
10 SASI_Rn02_00217577 predicted 734
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172745 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00344579 predicted 995
2 SASI_Mm01_00136613 predicted 1375
3 SASI_Mm02_00344580 predicted 989
4 SASI_Mm01_00136616 predicted 373
5 SASI_Mm02_00344581 predicted 586
6 SASI_Mm01_00136617 predicted 531
7 SASI_Mm01_00136618 predicted 1220
8 SASI_Mm01_00136619 predicted 1111
9 SASI_Mm01_00136620 predicted 576
10 SASI_Mm02_00344582 predicted 1129
11 SASI_Mm01_00136612 predicted 934
12 SASI_Mm01_00136614 predicted 634
13 SASI_Mm01_00136615 predicted 276
14 SASI_Mm01_00136621 predicted 409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003321
VALIDATED
TUFM MISSION shRNA Bacterial Glycerol Stock
Tu translation elongation factor, mitochondrial
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000166529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003321.3-1124s1c1
Sequence:CCGGCCAGGTTTACATCCTCAGCAACTCGAGTTGCTGAGGATGTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-1266s1c1
Sequence:CCGGGAGGACCTGAAGTTCAACCTACTCGAGTAGGTTGAACTTCAGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003321.3-332s1c1
Sequence:CCGGGAAGTACGAGGAGATTGACAACTCGAGTTGTCAATCTCCTCGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-1296s1c1
Sequence:CCGGCAGCCAATGATCTTAGAGAAACTCGAGTTTCTCTAAGATCATTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-668s1c1
Sequence:CCGGGCTCACCGAGTTTGGCTATAACTCGAGTTATAGCCAAACTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000165718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-945s1c1
Sequence:CCGGCATAGCAAGAACATCCGCACTCTCGAGAGTGCGGATGTTCTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1031s21c1
Sequence:CCGGCATAGCAAGAACATCCGCACTCTCGAGAGTGCGGATGTTCTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-754s21c1
Sequence:CCGGGCTCACCGAGTTTGGCTATAACTCGAGTTATAGCCAAACTCGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1352s21c1
Sequence:CCGGGAGGACCTGAAGTTCAACCTACTCGAGTAGGTTGAACTTCAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1382s21c1
Sequence:CCGGCAGCCAATGATCTTAGAGAAACTCGAGTTTCTCTAAGATCATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003321
VALIDATED
TUFM MISSION shRNA shRNA Plasmid DNA
Tu translation elongation factor, mitochondrial
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000166529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003321.3-1124s1c1
Sequence:CCGGCCAGGTTTACATCCTCAGCAACTCGAGTTGCTGAGGATGTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-1266s1c1
Sequence:CCGGGAGGACCTGAAGTTCAACCTACTCGAGTAGGTTGAACTTCAGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003321.3-332s1c1
Sequence:CCGGGAAGTACGAGGAGATTGACAACTCGAGTTGTCAATCTCCTCGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-1296s1c1
Sequence:CCGGCAGCCAATGATCTTAGAGAAACTCGAGTTTCTCTAAGATCATTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-668s1c1
Sequence:CCGGGCTCACCGAGTTTGGCTATAACTCGAGTTATAGCCAAACTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000165718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-945s1c1
Sequence:CCGGCATAGCAAGAACATCCGCACTCTCGAGAGTGCGGATGTTCTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1031s21c1
Sequence:CCGGCATAGCAAGAACATCCGCACTCTCGAGAGTGCGGATGTTCTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-754s21c1
Sequence:CCGGGCTCACCGAGTTTGGCTATAACTCGAGTTATAGCCAAACTCGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1352s21c1
Sequence:CCGGGAGGACCTGAAGTTCAACCTACTCGAGTAGGTTGAACTTCAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1382s21c1
Sequence:CCGGCAGCCAATGATCTTAGAGAAACTCGAGTTTCTCTAAGATCATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003321
VALIDATED
TUFM MISSION shRNA Lentiviral Transduction Particles
Tu translation elongation factor, mitochondrial
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000166529    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003321.3-1124s1c1
Sequence:CCGGCCAGGTTTACATCCTCAGCAACTCGAGTTGCTGAGGATGTAAACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165471    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-1266s1c1
Sequence:CCGGGAGGACCTGAAGTTCAACCTACTCGAGTAGGTTGAACTTCAGGTCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160932    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003321.3-332s1c1
Sequence:CCGGGAAGTACGAGGAGATTGACAACTCGAGTTGTCAATCTCCTCGTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160152    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-1296s1c1
Sequence:CCGGCAGCCAATGATCTTAGAGAAACTCGAGTTTCTCTAAGATCATTGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164867    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-668s1c1
Sequence:CCGGGCTCACCGAGTTTGGCTATAACTCGAGTTATAGCCAAACTCGGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000165718    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_003321.3-945s1c1
Sequence:CCGGCATAGCAAGAACATCCGCACTCTCGAGAGTGCGGATGTTCTTGCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1031s21c1
Sequence:CCGGCATAGCAAGAACATCCGCACTCTCGAGAGTGCGGATGTTCTTGCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280863    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-754s21c1
Sequence:CCGGGCTCACCGAGTTTGGCTATAACTCGAGTTATAGCCAAACTCGGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1352s21c1
Sequence:CCGGGAGGACCTGAAGTTCAACCTACTCGAGTAGGTTGAACTTCAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003321.4-1382s21c1
Sequence:CCGGCAGCCAATGATCTTAGAGAAACTCGAGTTTCTCTAAGATCATTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172745
VALIDATED
TUFM MISSION shRNA Bacterial Glycerol Stock
Tu translation elongation factor, mitochondrial
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.1-1232s1c1
Sequence:CCGGGCTTAGTCTAATCTTGCGGCACTCGAGTGCCGCAAGATTAGACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172745.1-1392s1c1
Sequence:CCGGCAGGTTATTGAGCTTCAGGCTCTCGAGAGCCTGAAGCTCAATAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.1-1250s1c1
Sequence:CCGGGCAGCCCATGATCTTAGAGAACTCGAGTTCTCTAAGATCATGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1380s21c1
Sequence:CCGGGGACTTCTGCTCAGGTTATTGCTCGAGCAATAACCTGAGCAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1117s21c1
Sequence:CCGGCAAACCCTTTGTATCTCATTTCTCGAGAAATGAGATACAAAGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-1117s1c1
Sequence:CCGGCAAACCCTTTGTATCTCATTTCTCGAGAAATGAGATACAAAGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-800s1c1
Sequence:CCGGGTAGAGTCAGTCTACTCTATTCTCGAGAATAGAGTAGACTGACTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-623s1c1
Sequence:CCGGCTCACCGAGTTTGGCTATAAACTCGAGTTTATAGCCAAACTCGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-504s21c1
Sequence:CCGGAGCACTTACTGCTAGCTAAACCTCGAGGTTTAGCTAGCAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-623s21c1
Sequence:CCGGCTCACCGAGTTTGGCTATAAACTCGAGTTTATAGCCAAACTCGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1222s21c1
Sequence:CCGGGGACTTGAAGCTTAGTCTAATCTCGAGATTAGACTAAGCTTCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172745
VALIDATED
TUFM MISSION shRNA shRNA Plasmid DNA
Tu translation elongation factor, mitochondrial
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.1-1232s1c1
Sequence:CCGGGCTTAGTCTAATCTTGCGGCACTCGAGTGCCGCAAGATTAGACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172745.1-1392s1c1
Sequence:CCGGCAGGTTATTGAGCTTCAGGCTCTCGAGAGCCTGAAGCTCAATAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.1-1250s1c1
Sequence:CCGGGCAGCCCATGATCTTAGAGAACTCGAGTTCTCTAAGATCATGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1380s21c1
Sequence:CCGGGGACTTCTGCTCAGGTTATTGCTCGAGCAATAACCTGAGCAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1117s21c1
Sequence:CCGGCAAACCCTTTGTATCTCATTTCTCGAGAAATGAGATACAAAGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-1117s1c1
Sequence:CCGGCAAACCCTTTGTATCTCATTTCTCGAGAAATGAGATACAAAGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-800s1c1
Sequence:CCGGGTAGAGTCAGTCTACTCTATTCTCGAGAATAGAGTAGACTGACTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-623s1c1
Sequence:CCGGCTCACCGAGTTTGGCTATAAACTCGAGTTTATAGCCAAACTCGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-504s21c1
Sequence:CCGGAGCACTTACTGCTAGCTAAACCTCGAGGTTTAGCTAGCAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-623s21c1
Sequence:CCGGCTCACCGAGTTTGGCTATAAACTCGAGTTTATAGCCAAACTCGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1222s21c1
Sequence:CCGGGGACTTGAAGCTTAGTCTAATCTCGAGATTAGACTAAGCTTCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172745
VALIDATED
TUFM MISSION shRNA Lentiviral Transduction Particles
Tu translation elongation factor, mitochondrial
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.1-1232s1c1
Sequence:CCGGGCTTAGTCTAATCTTGCGGCACTCGAGTGCCGCAAGATTAGACTAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195806    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172745.1-1392s1c1
Sequence:CCGGCAGGTTATTGAGCTTCAGGCTCTCGAGAGCCTGAAGCTCAATAACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196122    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.1-1250s1c1
Sequence:CCGGGCAGCCCATGATCTTAGAGAACTCGAGTTCTCTAAGATCATGGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248734    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1380s21c1
Sequence:CCGGGGACTTCTGCTCAGGTTATTGCTCGAGCAATAACCTGAGCAGAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1117s21c1
Sequence:CCGGCAAACCCTTTGTATCTCATTTCTCGAGAAATGAGATACAAAGGGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-1117s1c1
Sequence:CCGGCAAACCCTTTGTATCTCATTTCTCGAGAAATGAGATACAAAGGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216536    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-800s1c1
Sequence:CCGGGTAGAGTCAGTCTACTCTATTCTCGAGAATAGAGTAGACTGACTCTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172745.2-623s1c1
Sequence:CCGGCTCACCGAGTTTGGCTATAAACTCGAGTTTATAGCCAAACTCGGTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-504s21c1
Sequence:CCGGAGCACTTACTGCTAGCTAAACCTCGAGGTTTAGCTAGCAGTAAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-623s21c1
Sequence:CCGGCTCACCGAGTTTGGCTATAAACTCGAGTTTATAGCCAAACTCGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248733    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172745.2-1222s21c1
Sequence:CCGGGGACTTGAAGCTTAGTCTAATCTCGAGATTAGACTAAGCTTCAAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks