EMAIL THIS PAGE TO A FRIEND
138 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011656 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011656 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011656 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020127 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020127 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020127 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU081131 MISSION® esiRNA esiRNA human TUFT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001126337 Rosetta Predictions human pricing
NM_020127 Rosetta Predictions human pricing
NM_001108948 Rosetta Predictions rat pricing
NM_011656 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126337 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00328467 predicted 1078
2 SASI_Hs02_00328468 predicted 879
3 SASI_Hs02_00328469 predicted 1007
4 SASI_Hs02_00328470 predicted 1133
5 SASI_Hs02_00328471 predicted 407
6 SASI_Hs02_00328472 predicted 393
7 SASI_Hs02_00328473 predicted 994
8 SASI_Hs02_00328474 predicted 766
9 SASI_Hs02_00328475 predicted 975
10 SASI_Hs02_00328476 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020127 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236161 predicted 1154
2 SASI_Hs01_00236163 predicted 954
3 SASI_Hs01_00236165 predicted 1087
4 SASI_Hs02_00352991 predicted 1206
5 SASI_Hs01_00236166 predicted 486
6 SASI_Hs01_00236167 predicted 463
7 SASI_Hs01_00236168 predicted 1074
8 SASI_Hs01_00236169 predicted 838
9 SASI_Hs02_00352992 predicted 1048
10 SASI_Hs01_00236170 predicted 415
11 SASI_Hs01_00236162 predicted 239
12 SASI_Hs01_00236164 predicted 277
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108948 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00243664 predicted 791
2 SASI_Rn02_00243665 predicted 838
3 SASI_Rn02_00243666 predicted 452
4 SASI_Rn02_00243667 predicted 656
5 SASI_Rn02_00243668 predicted 644
6 SASI_Rn02_00243669 predicted 1103
7 SASI_Rn02_00243670 predicted 1147
8 SASI_Rn02_00243671 predicted 1300
9 SASI_Rn02_00243672 predicted 1264
10 SASI_Rn02_00243673 predicted 647
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011656 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321151 predicted 619
2 SASI_Mm01_00184149 predicted 512
3 SASI_Mm01_00184150 predicted 920
4 SASI_Mm01_00184151 predicted 984
5 SASI_Mm01_00184153 predicted 1108
6 SASI_Mm01_00184154 predicted 971
7 SASI_Mm01_00184155 predicted 1257
8 SASI_Mm01_00184156 predicted 240
9 SASI_Mm01_00184157 predicted 966
10 SASI_Mm02_00321152 predicted 913
11 SASI_Mm01_00184152 predicted 433
12 SASI_Mm01_00184158 predicted 456
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011656
VALIDATED
TUFT1 MISSION shRNA Bacterial Glycerol Stock
tuftelin 1
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-688s21c1
Sequence:CCGGGGAGCAGAAAGCGGCAGAAATCTCGAGATTTCTGCCGCTTTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-1411s21c1
Sequence:CCGGGAACGAAGCAATACCCTTATTCTCGAGAATAAGGGTATTGCTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011656.2-615s21c1
Sequence:CCGGAGGTCACACTCAGCCGTTATCCTCGAGGATAACGGCTGAGTGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011656.2-1045s21c1
Sequence:CCGGCGACCGCATGGAGCATCTAATCTCGAGATTAGATGCTCCATGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-244s21c1
Sequence:CCGGTGAAGAGATCATTAAGGTTTACTCGAGTAAACCTTAATGATCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011656.1-2379s1c1
Sequence:CCGGGCTCACAACCAGAAGCCTTAACTCGAGTTAAGGCTTCTGGTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011656
VALIDATED
TUFT1 MISSION shRNA shRNA Plasmid DNA
tuftelin 1
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-688s21c1
Sequence:CCGGGGAGCAGAAAGCGGCAGAAATCTCGAGATTTCTGCCGCTTTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-1411s21c1
Sequence:CCGGGAACGAAGCAATACCCTTATTCTCGAGAATAAGGGTATTGCTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011656.2-615s21c1
Sequence:CCGGAGGTCACACTCAGCCGTTATCCTCGAGGATAACGGCTGAGTGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011656.2-1045s21c1
Sequence:CCGGCGACCGCATGGAGCATCTAATCTCGAGATTAGATGCTCCATGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-244s21c1
Sequence:CCGGTGAAGAGATCATTAAGGTTTACTCGAGTAAACCTTAATGATCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011656.1-2379s1c1
Sequence:CCGGGCTCACAACCAGAAGCCTTAACTCGAGTTAAGGCTTCTGGTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011656
VALIDATED
TUFT1 MISSION shRNA Lentiviral Transduction Particles
tuftelin 1
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-688s21c1
Sequence:CCGGGGAGCAGAAAGCGGCAGAAATCTCGAGATTTCTGCCGCTTTCTGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246652    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-1411s21c1
Sequence:CCGGGAACGAAGCAATACCCTTATTCTCGAGAATAAGGGTATTGCTTCGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246653    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011656.2-615s21c1
Sequence:CCGGAGGTCACACTCAGCCGTTATCCTCGAGGATAACGGCTGAGTGTGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011656.2-1045s21c1
Sequence:CCGGCGACCGCATGGAGCATCTAATCTCGAGATTAGATGCTCCATGCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246650    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011656.2-244s21c1
Sequence:CCGGTGAAGAGATCATTAAGGTTTACTCGAGTAAACCTTAATGATCTCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190098    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_011656.1-2379s1c1
Sequence:CCGGGCTCACAACCAGAAGCCTTAACTCGAGTTAAGGCTTCTGGTTGTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020127
VALIDATED
TUFT1 MISSION shRNA Bacterial Glycerol Stock
tuftelin 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000231073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-277s21c1
Sequence:CCGGATGGACATGAGGAGATCATTACTCGAGTAATGATCTCCTCATGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-403s21c1
Sequence:CCGGAGAAGCTCCGGGAGGATATAACTCGAGTTATATCCTCCCGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020127.2-2121s21c1
Sequence:GTACCGGATAGCCTTCTCTTGCAGTATTCTCGAGAATACTGCAAGAGAAGGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-539s21c1
Sequence:CCGGTGAGGTGGACACCTGTATAAACTCGAGTTTATACAGGTGTCCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000231074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-332s21c1
Sequence:CCGGGATTCACGAGAAGAATATTAACTCGAGTTAATATTCTTCTCGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020127.1-2393s1c1
Sequence:CCGGCCTTGCTCCATAATTGGTCTTCTCGAGAAGACCAATTATGGAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-687s1c1
Sequence:CCGGGAACAAAGTAATGTGGCCCTTCTCGAGAAGGGCCACATTACTTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-1089s1c1
Sequence:CCGGCGGATGGAACACCTGATAGAACTCGAGTTCTATCAGGTGTTCCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-1065s1c1
Sequence:CCGGGCAGAGAATTTAGAGATGCATCTCGAGATGCATCTCTAAATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020127
VALIDATED
TUFT1 MISSION shRNA shRNA Plasmid DNA
tuftelin 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000231073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-277s21c1
Sequence:CCGGATGGACATGAGGAGATCATTACTCGAGTAATGATCTCCTCATGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-403s21c1
Sequence:CCGGAGAAGCTCCGGGAGGATATAACTCGAGTTATATCCTCCCGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020127.2-2121s21c1
Sequence:GTACCGGATAGCCTTCTCTTGCAGTATTCTCGAGAATACTGCAAGAGAAGGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-539s21c1
Sequence:CCGGTGAGGTGGACACCTGTATAAACTCGAGTTTATACAGGTGTCCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000231074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-332s21c1
Sequence:CCGGGATTCACGAGAAGAATATTAACTCGAGTTAATATTCTTCTCGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020127.1-2393s1c1
Sequence:CCGGCCTTGCTCCATAATTGGTCTTCTCGAGAAGACCAATTATGGAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-687s1c1
Sequence:CCGGGAACAAAGTAATGTGGCCCTTCTCGAGAAGGGCCACATTACTTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-1089s1c1
Sequence:CCGGCGGATGGAACACCTGATAGAACTCGAGTTCTATCAGGTGTTCCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-1065s1c1
Sequence:CCGGGCAGAGAATTTAGAGATGCATCTCGAGATGCATCTCTAAATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020127
VALIDATED
TUFT1 MISSION shRNA Lentiviral Transduction Particles
tuftelin 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000231073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-277s21c1
Sequence:CCGGATGGACATGAGGAGATCATTACTCGAGTAATGATCTCCTCATGTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231075    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-403s21c1
Sequence:CCGGAGAAGCTCCGGGAGGATATAACTCGAGTTATATCCTCCCGGAGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218896    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020127.2-2121s21c1
Sequence:GTACCGGATAGCCTTCTCTTGCAGTATTCTCGAGAATACTGCAAGAGAAGGCTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231076    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-539s21c1
Sequence:CCGGTGAGGTGGACACCTGTATAAACTCGAGTTTATACAGGTGTCCACCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000231074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020127.2-332s21c1
Sequence:CCGGGATTCACGAGAAGAATATTAACTCGAGTTAATATTCTTCTCGTGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005717    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_020127.1-2393s1c1
Sequence:CCGGCCTTGCTCCATAATTGGTCTTCTCGAGAAGACCAATTATGGAGCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-687s1c1
Sequence:CCGGGAACAAAGTAATGTGGCCCTTCTCGAGAAGGGCCACATTACTTTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-1089s1c1
Sequence:CCGGCGGATGGAACACCTGATAGAACTCGAGTTCTATCAGGTGTTCCATCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020127.1-1065s1c1
Sequence:CCGGGCAGAGAATTTAGAGATGCATCTCGAGATGCATCTCTAAATTCTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks