EMAIL THIS PAGE TO A FRIEND

TUG1

taurine upregulated 1 (non-protein coding)

Synonyms: LINC00080 NCRNA00080 TI-227H
Species: Human TUG1(55000), Mouse Tug1(544752)
Gene ID:
Mouse(544752) taurine upregulated gene 1
382 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017903 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017903 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017903 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NR_002323 Rosetta Predictions human pricing
NR_002321 Rosetta Predictions mouse pricing
NR_002322 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00375882 predicted 3293
2 SASI_Hs02_00375883 predicted 2423
3 SASI_Hs02_00375884 predicted 2808
4 SASI_Hs02_00375885 predicted 4332
5 SASI_Hs02_00375886 predicted 4555
6 SASI_Hs02_00375887 predicted 5201
7 SASI_Hs02_00375888 predicted 4463
8 SASI_Hs02_00375889 predicted 4545
9 SASI_Hs02_00375890 predicted 5437
10 SASI_Hs02_00375891 predicted 3452
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002321 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352522 predicted 4436
2 SASI_Mm02_00352523 predicted 4300
3 SASI_Mm02_00352524 predicted 1855
4 SASI_Mm02_00352525 predicted 4480
5 SASI_Mm02_00352526 predicted 4008
6 SASI_Mm02_00352527 predicted 2101
7 SASI_Mm02_00352528 predicted 3249
8 SASI_Mm02_00352529 predicted 1984
9 SASI_Mm02_00352530 predicted 1819
10 SASI_Mm02_00352531 predicted 2862
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_002322 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00352532 predicted 2825
2 SASI_Mm02_00352533 predicted 1901
3 SASI_Mm02_00352534 predicted 389
4 SASI_Mm02_00352535 predicted 2532
5 SASI_Mm02_00352536 predicted 342
6 SASI_Mm02_00352537 predicted 2782
7 SASI_Mm02_00352538 predicted 1128
8 SASI_Mm02_00352539 predicted 2392
9 SASI_Mm02_00352540 predicted 2633
10 SASI_Mm02_00352541 predicted 2380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017903
VALIDATED
TUG1 MISSION shRNA Bacterial Glycerol Stock
taurine upregulated 1 (non-protein coding)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-705s1c1
Sequence:CCGGGCTCCATCCAAAGTGAATTATCTCGAGATAATTCACTTTGGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-655s1c1
Sequence:CCGGGAATTAGAAGACCTGAGTTTCCTCGAGGAAACTCAGGTCTTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017903.2-2186s1c1
Sequence:CCGGGCCAAATTCAAATACTGGCAACTCGAGTTGCCAGTATTTGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017903.2-2047s1c1
Sequence:CCGGCCTCCATGAATACCTGAATTACTCGAGTAATTCAGGTATTCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-847s1c1
Sequence:CCGGCTACTGACGAAGACACCCATTCTCGAGAATGGGTGTCTTCGTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-702s1c1
Sequence:CCGGGATGCTCCATCCAAAGTGAATCTCGAGATTCACTTTGGATGGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-825s1c1
Sequence:CCGGCGAGATGATTCCTACCACCTTCTCGAGAAGGTGGTAGGAATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-781s1c1
Sequence:CCGGGTGCTATTCCATCAGCCTACACTCGAGTGTAGGCTGATGGAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-661s1c1
Sequence:CCGGGAAGACCTGAGTTTCTGTCCACTCGAGTGGACAGAAACTCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-589s1c1
Sequence:CCGGCTGTTGACCTTGCTGTGAGAACTCGAGTTCTCACAGCAAGGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-738s1c1
Sequence:CCGGCTGATTGCTGAGTGTTCACCTCTCGAGAGGTGAACACTCAGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-768s1c1
Sequence:CCGGGACTACCTTCCCTGTGCTATTCTCGAGAATAGCACAGGGAAGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017903
VALIDATED
TUG1 MISSION shRNA shRNA Plasmid DNA
taurine upregulated 1 (non-protein coding)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-705s1c1
Sequence:CCGGGCTCCATCCAAAGTGAATTATCTCGAGATAATTCACTTTGGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-655s1c1
Sequence:CCGGGAATTAGAAGACCTGAGTTTCCTCGAGGAAACTCAGGTCTTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017903.2-2186s1c1
Sequence:CCGGGCCAAATTCAAATACTGGCAACTCGAGTTGCCAGTATTTGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017903.2-2047s1c1
Sequence:CCGGCCTCCATGAATACCTGAATTACTCGAGTAATTCAGGTATTCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-847s1c1
Sequence:CCGGCTACTGACGAAGACACCCATTCTCGAGAATGGGTGTCTTCGTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-702s1c1
Sequence:CCGGGATGCTCCATCCAAAGTGAATCTCGAGATTCACTTTGGATGGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-825s1c1
Sequence:CCGGCGAGATGATTCCTACCACCTTCTCGAGAAGGTGGTAGGAATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-781s1c1
Sequence:CCGGGTGCTATTCCATCAGCCTACACTCGAGTGTAGGCTGATGGAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-661s1c1
Sequence:CCGGGAAGACCTGAGTTTCTGTCCACTCGAGTGGACAGAAACTCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-589s1c1
Sequence:CCGGCTGTTGACCTTGCTGTGAGAACTCGAGTTCTCACAGCAAGGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-738s1c1
Sequence:CCGGCTGATTGCTGAGTGTTCACCTCTCGAGAGGTGAACACTCAGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-768s1c1
Sequence:CCGGGACTACCTTCCCTGTGCTATTCTCGAGAATAGCACAGGGAAGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017903
VALIDATED
TUG1 MISSION shRNA Lentiviral Transduction Particles
taurine upregulated 1 (non-protein coding)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-705s1c1
Sequence:CCGGGCTCCATCCAAAGTGAATTATCTCGAGATAATTCACTTTGGATGGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144828    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-655s1c1
Sequence:CCGGGAATTAGAAGACCTGAGTTTCCTCGAGGAAACTCAGGTCTTCTAATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144980    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017903.2-2186s1c1
Sequence:CCGGGCCAAATTCAAATACTGGCAACTCGAGTTGCCAGTATTTGAATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144410    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_017903.2-2047s1c1
Sequence:CCGGCCTCCATGAATACCTGAATTACTCGAGTAATTCAGGTATTCATGGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122359    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-847s1c1
Sequence:CCGGCTACTGACGAAGACACCCATTCTCGAGAATGGGTGTCTTCGTCAGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143548    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-702s1c1
Sequence:CCGGGATGCTCCATCCAAAGTGAATCTCGAGATTCACTTTGGATGGAGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139468    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-825s1c1
Sequence:CCGGCGAGATGATTCCTACCACCTTCTCGAGAAGGTGGTAGGAATCATCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139979    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-781s1c1
Sequence:CCGGGTGCTATTCCATCAGCCTACACTCGAGTGTAGGCTGATGGAATAGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140077    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_017903.2-661s1c1
Sequence:CCGGGAAGACCTGAGTTTCTGTCCACTCGAGTGGACAGAAACTCAGGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_017903.2-589s1c1
Sequence:CCGGCTGTTGACCTTGCTGTGAGAACTCGAGTTCTCACAGCAAGGTCAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-738s1c1
Sequence:CCGGCTGATTGCTGAGTGTTCACCTCTCGAGAGGTGAACACTCAGCAATCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_017903.2-768s1c1
Sequence:CCGGGACTACCTTCCCTGTGCTATTCTCGAGAATAGCACAGGGAAGGTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks