EMAIL THIS PAGE TO A FRIEND

TULP1

tubby like protein 1

Synonyms: LCA15 RP14 TUBL1
UniProtKB ID: O00294, O43536, Q5TGM5, Q8N571
Gene ID:
Human(7287) Summary: This gene encodes a member of the tubby-like gene family (TULPs). Members of this family have been identified in plants, vertebrates, and invertebrates and encode proteins of unknown function. TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. Mutations in this gene may be associated with retinitis pigmentosa. [provided by RefSeq, Jul 2008]
Mouse(22157) tubby like protein 1
Rat(309900) tubby like protein 1
chicken(395321) tubby like protein 1
domestic cat(101099126) tubby like protein 1
dog(481758) tubby like protein 1
cow(613862) tubby like protein 1
sheep(101118311) tubby like protein 1
domestic guinea pig(100724314) tubby like protein 1
naked mole-rat(101707456) tubby like protein 1
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108750 Anti-TULP1 affinity isolated antibody guinea pig, human, rabbit, yeast, horse, canine, rat, mouse, rat
western blot pricing
SAB1304878 ANTI-TULP1 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB2104188 Anti-TULP1 antibody produced in rabbit affinity isolated antibody guinea pig, rat, rabbit, human, horse, bovine, mouse
western blot pricing
SAB2700274 Anti-TULP1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021478 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021478 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021478 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003322 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003322 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003322 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU029791 MISSION® esiRNA esiRNA targeting mouse Tulp1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003322 Rosetta Predictions human pricing
NM_001107642 Rosetta Predictions rat pricing
NM_021478 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003322 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00097768 predicted 1381
2 SASI_Hs01_00097769 predicted 1709
3 SASI_Hs01_00097771 predicted 1146
4 SASI_Hs02_00335459 predicted 1140
5 SASI_Hs02_00335460 predicted 1051
6 SASI_Hs01_00097774 predicted 1189
7 SASI_Hs02_00335461 predicted 1503
8 SASI_Hs02_00335462 predicted 1285
9 SASI_Hs02_00335463 predicted 1468
10 SASI_Hs02_00335464 predicted 1062
11 SASI_Hs01_00097770 predicted 1040
12 SASI_Hs01_00097772 predicted 966
13 SASI_Hs01_00097773 predicted 994
14 SASI_Hs01_00097775 predicted 1377
15 SASI_Hs01_00097776 predicted 970
16 SASI_Hs01_00097777 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107642 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230845 predicted 732
2 SASI_Rn02_00230846 predicted 1318
3 SASI_Rn02_00230847 predicted 1084
4 SASI_Rn02_00230848 predicted 777
5 SASI_Rn02_00230849 predicted 592
6 SASI_Rn02_00230850 predicted 964
7 SASI_Rn02_00230851 predicted 863
8 SASI_Rn02_00230852 predicted 1246
9 SASI_Rn02_00230853 predicted 1148
10 SASI_Rn02_00230854 predicted 1161
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021478 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190414 predicted 1396
2 SASI_Mm01_00190415 predicted 1283
3 SASI_Mm01_00190416 predicted 1483
4 SASI_Mm01_00190417 predicted 1058
5 SASI_Mm01_00190418 predicted 1439
6 SASI_Mm01_00190419 predicted 1506
7 SASI_Mm01_00190420 predicted 1244
8 SASI_Mm01_00190421 predicted 1511
9 SASI_Mm01_00190422 predicted 1242
10 SASI_Mm02_00326163 predicted 1014
11 SASI_Mm01_00190423 predicted 1373
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021478
TULP1 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1242s1c1
Sequence:CCGGGCTGTGGTCTATGAAACCAATCTCGAGATTGGTTTCATAGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1058s1c1
Sequence:CCGGGCGGAGTAAGACAGCCAACTACTCGAGTAGTTGGCTGTCTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1487s1c1
Sequence:CCGGCTCCGTCAAGAACTTTCAGATCTCGAGATCTGAAAGTTCTTGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-732s1c1
Sequence:CCGGCCTCCTAAAGGTTCAGAGGAACTCGAGTTCCTCTGAACCTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-797s1c1
Sequence:CCGGCGCAGTGATGAAGAACAGCAACTCGAGTTGCTGTTCTTCATCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021478
TULP1 MISSION shRNA shRNA Plasmid DNA
tubby like protein 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1242s1c1
Sequence:CCGGGCTGTGGTCTATGAAACCAATCTCGAGATTGGTTTCATAGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1058s1c1
Sequence:CCGGGCGGAGTAAGACAGCCAACTACTCGAGTAGTTGGCTGTCTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1487s1c1
Sequence:CCGGCTCCGTCAAGAACTTTCAGATCTCGAGATCTGAAAGTTCTTGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-732s1c1
Sequence:CCGGCCTCCTAAAGGTTCAGAGGAACTCGAGTTCCTCTGAACCTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-797s1c1
Sequence:CCGGCGCAGTGATGAAGAACAGCAACTCGAGTTGCTGTTCTTCATCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021478
TULP1 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1242s1c1
Sequence:CCGGGCTGTGGTCTATGAAACCAATCTCGAGATTGGTTTCATAGACCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034511    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1058s1c1
Sequence:CCGGGCGGAGTAAGACAGCCAACTACTCGAGTAGTTGGCTGTCTTACTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-1487s1c1
Sequence:CCGGCTCCGTCAAGAACTTTCAGATCTCGAGATCTGAAAGTTCTTGACGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-732s1c1
Sequence:CCGGCCTCCTAAAGGTTCAGAGGAACTCGAGTTCCTCTGAACCTTTAGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034513    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021478.1-797s1c1
Sequence:CCGGCGCAGTGATGAAGAACAGCAACTCGAGTTGCTGTTCTTCATCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003322
TULP1 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000084023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003322.2-1841s1c1
Sequence:CCGGCGGAGATGAAGAACATCTGGACTCGAGTCCAGATGTTCTTCATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-782s1c1
Sequence:CCGGGTGATAAAGAACAGCAATCAACTCGAGTTGATTGCTGTTCTTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-1507s1c1
Sequence:CCGGCGACTATATCGTGCTGCAGTTCTCGAGAACTGCAGCACGATATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-54s1c1
Sequence:CCGGACAGTGGGCATGAAGAAGAAACTCGAGTTTCTTCTTCATGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000084024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-1381s1c1
Sequence:CCGGCCTCATAGAACTGCACAACAACTCGAGTTGTTGTGCAGTTCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003322.3-772s21c1
Sequence:CCGGGAGGCAGCTACGGTGATAAAGCTCGAGCTTTATCACCGTAGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003322.3-537s21c1
Sequence:CCGGACCGAAACCTCTGCGTGTTAGCTCGAGCTAACACGCAGAGGTTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003322
TULP1 MISSION shRNA shRNA Plasmid DNA
tubby like protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000084023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003322.2-1841s1c1
Sequence:CCGGCGGAGATGAAGAACATCTGGACTCGAGTCCAGATGTTCTTCATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-782s1c1
Sequence:CCGGGTGATAAAGAACAGCAATCAACTCGAGTTGATTGCTGTTCTTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-1507s1c1
Sequence:CCGGCGACTATATCGTGCTGCAGTTCTCGAGAACTGCAGCACGATATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-54s1c1
Sequence:CCGGACAGTGGGCATGAAGAAGAAACTCGAGTTTCTTCTTCATGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000084024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-1381s1c1
Sequence:CCGGCCTCATAGAACTGCACAACAACTCGAGTTGTTGTGCAGTTCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003322.3-772s21c1
Sequence:CCGGGAGGCAGCTACGGTGATAAAGCTCGAGCTTTATCACCGTAGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003322.3-537s21c1
Sequence:CCGGACCGAAACCTCTGCGTGTTAGCTCGAGCTAACACGCAGAGGTTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003322
TULP1 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000084023    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003322.2-1841s1c1
Sequence:CCGGCGGAGATGAAGAACATCTGGACTCGAGTCCAGATGTTCTTCATCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084025    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-782s1c1
Sequence:CCGGGTGATAAAGAACAGCAATCAACTCGAGTTGATTGCTGTTCTTTATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084026    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-1507s1c1
Sequence:CCGGCGACTATATCGTGCTGCAGTTCTCGAGAACTGCAGCACGATATAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084027    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-54s1c1
Sequence:CCGGACAGTGGGCATGAAGAAGAAACTCGAGTTTCTTCTTCATGCCCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000084024    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003322.2-1381s1c1
Sequence:CCGGCCTCATAGAACTGCACAACAACTCGAGTTGTTGTGCAGTTCTATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440463    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003322.3-772s21c1
Sequence:CCGGGAGGCAGCTACGGTGATAAAGCTCGAGCTTTATCACCGTAGCTGCCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438477    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003322.3-537s21c1
Sequence:CCGGACCGAAACCTCTGCGTGTTAGCTCGAGCTAACACGCAGAGGTTTCGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks