EMAIL THIS PAGE TO A FRIEND

TULP2

tubby like protein 2

Synonyms: CT65 TUBL2
UniProtKB ID: O00295, Q8TC50
Gene ID:
Human(7288) Summary: TULP2 is a member of a family of tubby-like genes (TULPs) that encode proteins of unknown function. Members of this family have been identified in plants, vertebrates, and invertebrates. The TULP proteins share a conserved C-terminal region of approximately 200 amino acid residues. [provided by RefSeq, Jul 2008]
Mouse(56734) tubby-like protein 2
Rat(361576) tubby-like protein 2
naked mole-rat(101709486) tubby like protein 2
domestic guinea pig(100727285) tubby like protein 2
cow(505350) tubby like protein 2
sheep(101102666) tubby like protein 2
Horse(100051453) tubby like protein 2
dog(484392) tubby like protein 2
domestic cat(101084331) tubby like protein 2
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003323 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003323 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003323 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008807 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008807 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008807 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003323 Rosetta Predictions human pricing
NM_001012168 Rosetta Predictions rat pricing
XM_574448 Rosetta Predictions rat pricing
NM_001045555 Rosetta Predictions mouse pricing
NM_008807 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003323 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00191446 predicted 685
2 SASI_Hs02_00335465 predicted 482
3 SASI_Hs01_00191447 predicted 1458
4 SASI_Hs01_00191448 predicted 1310
5 SASI_Hs01_00191449 predicted 1395
6 SASI_Hs01_00191450 predicted 1160
7 SASI_Hs01_00191451 predicted 940
8 SASI_Hs01_00191452 predicted 1373
9 SASI_Hs01_00191453 predicted 1088
10 SASI_Hs01_00191454 predicted 1333
11 SASI_Hs01_00191455 predicted 860
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012168 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00113475 predicted 678
2 SASI_Rn01_00113476 predicted 1086
3 SASI_Rn01_00113477 predicted 511
4 SASI_Rn01_00113478 predicted 878
5 SASI_Rn01_00113479 predicted 1041
6 SASI_Rn01_00113480 predicted 452
7 SASI_Rn01_00113481 predicted 1030
8 SASI_Rn01_00113483 predicted 1015
9 SASI_Rn01_00113484 predicted 1113
10 SASI_Rn02_00200364 predicted 195
11 SASI_Rn01_00113482 predicted 988
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_574448 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00183413 predicted 1333
2 SASI_Rn01_00183414 predicted 768
3 SASI_Rn01_00183415 predicted 1398
4 SASI_Rn01_00183416 predicted 742
5 SASI_Rn01_00183417 predicted 1429
6 SASI_Rn01_00183418 predicted 683
7 SASI_Rn01_00183419 predicted 1346
8 SASI_Rn01_00183420 predicted 608
9 SASI_Rn01_00183421 predicted 891
10 SASI_Rn01_00183422 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001045555 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00291801 predicted 1216
2 SASI_Mm02_00291802 predicted 371
3 SASI_Mm02_00291803 predicted 1216
4 SASI_Mm02_00291804 predicted 1184
5 SASI_Mm02_00291805 predicted 706
6 SASI_Mm02_00291806 predicted 1312
7 SASI_Mm02_00291807 predicted 1222
8 SASI_Mm02_00291808 predicted 706
9 SASI_Mm02_00291809 predicted 1084
10 SASI_Mm02_00291810 predicted 1187
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008807 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00094743 predicted 1214
2 SASI_Mm02_00314724 predicted 366
3 SASI_Mm02_00314725 predicted 1212
4 SASI_Mm02_00314726 predicted 1188
5 SASI_Mm02_00314727 predicted 707
6 SASI_Mm02_00314728 predicted 1311
7 SASI_Mm01_00094748 predicted 1227
8 SASI_Mm02_00314729 predicted 708
9 SASI_Mm02_00314730 predicted 1085
10 SASI_Mm02_00314731 predicted 1195
11 SASI_Mm01_00094744 predicted 490
12 SASI_Mm01_00094745 predicted 629
13 SASI_Mm01_00094746 predicted 742
14 SASI_Mm01_00094747 predicted 409
15 SASI_Mm01_00094749 predicted 736
16 SASI_Mm01_00094750 predicted 529
17 SASI_Mm01_00094751 predicted 423
18 SASI_Mm01_00094752 predicted 415
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003323
TULP2 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-708s21c1
Sequence:CCGGATGCACACAAGTCACCCAATACTCGAGTATTGGGTGACTTGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-861s21c1
Sequence:CCGGAGTTGTCCAAGGCCCTGAAAGCTCGAGCTTTCAGGGCCTTGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-1323s21c1
Sequence:CCGGGTTATGAGCCCAACGTCTTAGCTCGAGCTAAGACGTTGGGCTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1210s1c1
Sequence:CCGGCGGGAGCATTTAACCAGGAATCTCGAGATTCCTGGTTAAATGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-686s1c1
Sequence:CCGGGAATGGATGGTGACTGTGTATCTCGAGATACACAGTCACCATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1060s1c1
Sequence:CCGGCGAAAGAGAAGAAGGAGCAAACTCGAGTTTGCTCCTTCTTCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1345s1c1
Sequence:CCGGCGAATCAATGTCCAGCCACTACTCGAGTAGTGGCTGGACATTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-487s1c1
Sequence:CCGGCCAGACAATTCCGATGCAGAACTCGAGTTCTGCATCGGAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003323
TULP2 MISSION shRNA shRNA Plasmid DNA
tubby like protein 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-708s21c1
Sequence:CCGGATGCACACAAGTCACCCAATACTCGAGTATTGGGTGACTTGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-861s21c1
Sequence:CCGGAGTTGTCCAAGGCCCTGAAAGCTCGAGCTTTCAGGGCCTTGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-1323s21c1
Sequence:CCGGGTTATGAGCCCAACGTCTTAGCTCGAGCTAAGACGTTGGGCTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1210s1c1
Sequence:CCGGCGGGAGCATTTAACCAGGAATCTCGAGATTCCTGGTTAAATGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-686s1c1
Sequence:CCGGGAATGGATGGTGACTGTGTATCTCGAGATACACAGTCACCATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1060s1c1
Sequence:CCGGCGAAAGAGAAGAAGGAGCAAACTCGAGTTTGCTCCTTCTTCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1345s1c1
Sequence:CCGGCGAATCAATGTCCAGCCACTACTCGAGTAGTGGCTGGACATTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-487s1c1
Sequence:CCGGCCAGACAATTCCGATGCAGAACTCGAGTTCTGCATCGGAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003323
TULP2 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433910    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-708s21c1
Sequence:CCGGATGCACACAAGTCACCCAATACTCGAGTATTGGGTGACTTGTGTGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423000    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-861s21c1
Sequence:CCGGAGTTGTCCAAGGCCCTGAAAGCTCGAGCTTTCAGGGCCTTGGACAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422400    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003323.2-1323s21c1
Sequence:CCGGGTTATGAGCCCAACGTCTTAGCTCGAGCTAAGACGTTGGGCTCATAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181054    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1210s1c1
Sequence:CCGGCGGGAGCATTTAACCAGGAATCTCGAGATTCCTGGTTAAATGCTCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179524    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-686s1c1
Sequence:CCGGGAATGGATGGTGACTGTGTATCTCGAGATACACAGTCACCATCCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178843    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1060s1c1
Sequence:CCGGCGAAAGAGAAGAAGGAGCAAACTCGAGTTTGCTCCTTCTTCTCTTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180636    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-1345s1c1
Sequence:CCGGCGAATCAATGTCCAGCCACTACTCGAGTAGTGGCTGGACATTGATTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181021    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003323.1-487s1c1
Sequence:CCGGCCAGACAATTCCGATGCAGAACTCGAGTTCTGCATCGGAATTGTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008807
TULP2 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-440s1c1
Sequence:CCGGCCAATGTCTTGGGCACGAAATCTCGAGATTTCGTGCCCAAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-541s1c1
Sequence:CCGGGTCGTCTGTTATGAGACCAATCTCGAGATTGGTCTCATAACAGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-415s1c1
Sequence:CCGGAGCAACTTTGTAGGCAAAGTTCTCGAGAACTTTGCCTACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-543s1c1
Sequence:CCGGCGTCTGTTATGAGACCAATGTCTCGAGACATTGGTCTCATAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-658s1c1
Sequence:CCGGGATTCCATATTGAGTCGCGTACTCGAGTACGCGACTCAATATGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008807
TULP2 MISSION shRNA shRNA Plasmid DNA
tubby like protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-440s1c1
Sequence:CCGGCCAATGTCTTGGGCACGAAATCTCGAGATTTCGTGCCCAAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-541s1c1
Sequence:CCGGGTCGTCTGTTATGAGACCAATCTCGAGATTGGTCTCATAACAGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-415s1c1
Sequence:CCGGAGCAACTTTGTAGGCAAAGTTCTCGAGAACTTTGCCTACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-543s1c1
Sequence:CCGGCGTCTGTTATGAGACCAATGTCTCGAGACATTGGTCTCATAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-658s1c1
Sequence:CCGGGATTCCATATTGAGTCGCGTACTCGAGTACGCGACTCAATATGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008807
TULP2 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103455    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-440s1c1
Sequence:CCGGCCAATGTCTTGGGCACGAAATCTCGAGATTTCGTGCCCAAGACATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103456    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-541s1c1
Sequence:CCGGGTCGTCTGTTATGAGACCAATCTCGAGATTGGTCTCATAACAGACGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103457    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-415s1c1
Sequence:CCGGAGCAACTTTGTAGGCAAAGTTCTCGAGAACTTTGCCTACAAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103459    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-543s1c1
Sequence:CCGGCGTCTGTTATGAGACCAATGTCTCGAGACATTGGTCTCATAACAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103458    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008807.1-658s1c1
Sequence:CCGGGATTCCATATTGAGTCGCGTACTCGAGTACGCGACTCAATATGGAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks