EMAIL THIS PAGE TO A FRIEND

TULP3

tubby like protein 3

Synonyms: TUBL3
UniProtKB ID: O75386, B3KNB7, D3DUQ4, Q8N5B0
Gene ID:
Human(7289) Summary: This gene encodes a member of the tubby gene family of bipartite transcription factors. Members of this family have been identified in plants, vertebrates, and invertebrates, and they share a conserved N-terminal transcription activation region and a conserved C-terminal DNA and phosphatidylinositol-phosphate binding region. The encoded protein binds to phosphoinositides in the plasma membrane via its C-terminal region and probably functions as a membrane-bound transcription regulator that translocates to the nucleus in response to phosphoinositide hydrolysis, for instance, induced by G-protein-coupled-receptor signaling. It plays an important role in neuronal development and function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, May 2009]
Mouse(22158) tubby-like protein 3
Rat(688749) tubby-like protein 3
chicken(426085) tubby like protein 3
domestic cat(101099056) tubby like protein 3
dog(611832) tubby like protein 3
cow(516380) tubby like protein 3
sheep(101113230) tubby like protein 3
domestic guinea pig(100715001) tubby like protein 3
naked mole-rat(101713939) tubby like protein 3
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003324 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003324 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003324 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011657 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011657 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011657 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003324 Rosetta Predictions human pricing
XM_001071995 Rosetta Predictions rat pricing
NM_011657 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003324 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00335466 predicted 1310
2 SASI_Hs01_00133619 predicted 505
3 SASI_Hs01_00133620 predicted 447
4 SASI_Hs01_00133621 predicted 678
5 SASI_Hs01_00133622 predicted 322
6 SASI_Hs02_00335467 predicted 1019
7 SASI_Hs01_00133623 predicted 1003
8 SASI_Hs01_00133624 predicted 840
9 SASI_Hs01_00133626 predicted 836
10 SASI_Hs01_00133627 predicted 475
11 SASI_Hs01_00133625 predicted 273
12 SASI_Hs01_00133628 predicted 1386
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071995 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337263 predicted 1264
2 SASI_Rn02_00337264 predicted 1279
3 SASI_Rn02_00337265 predicted 842
4 SASI_Rn02_00337266 predicted 1064
5 SASI_Rn02_00337267 predicted 470
6 SASI_Rn02_00337268 predicted 1010
7 SASI_Rn02_00337269 predicted 910
8 SASI_Rn02_00337270 predicted 1048
9 SASI_Rn02_00337271 predicted 276
10 SASI_Rn02_00337272 predicted 1250
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011657 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078821 predicted 891
2 SASI_Mm01_00078822 predicted 1893
3 SASI_Mm01_00078824 predicted 1893
4 SASI_Mm01_00078825 predicted 801
5 SASI_Mm01_00078826 predicted 1148
6 SASI_Mm02_00321153 predicted 198
7 SASI_Mm01_00078827 predicted 1052
8 SASI_Mm01_00078828 predicted 1250
9 SASI_Mm01_00078829 predicted 781
10 SASI_Mm01_00078830 predicted 318
11 SASI_Mm01_00078823 predicted 837
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003324
TULP3 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 3
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003324.3-2286s1c1
Sequence:CCGGCCACGTATTATGTGACTCTTACTCGAGTAAGAGTCACATAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-740s1c1
Sequence:CCGGCCTACTATATGTACTTGGAAACTCGAGTTTCCAAGTACATATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-521s1c1
Sequence:CCGGCCCAGTCAGCATGTTTAGAAACTCGAGTTTCTAAACATGCTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-844s1c1
Sequence:CCGGCCAGTTGATTTATCTCGTGAACTCGAGTTCACGAGATAAATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-151s1c1
Sequence:CCGGCGACAGGCTAAGCTGGATTATCTCGAGATAATCCAGCTTAGCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003324.4-681s21c1
Sequence:CCGGCACAGTAAGATGTCGGATAATCTCGAGATTATCCGACATCTTACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003324.4-617s21c1
Sequence:CCGGATAACCTCCTGGGAGACATAGCTCGAGCTATGTCTCCCAGGAGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003324
TULP3 MISSION shRNA shRNA Plasmid DNA
tubby like protein 3
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003324.3-2286s1c1
Sequence:CCGGCCACGTATTATGTGACTCTTACTCGAGTAAGAGTCACATAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-740s1c1
Sequence:CCGGCCTACTATATGTACTTGGAAACTCGAGTTTCCAAGTACATATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-521s1c1
Sequence:CCGGCCCAGTCAGCATGTTTAGAAACTCGAGTTTCTAAACATGCTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-844s1c1
Sequence:CCGGCCAGTTGATTTATCTCGTGAACTCGAGTTCACGAGATAAATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-151s1c1
Sequence:CCGGCGACAGGCTAAGCTGGATTATCTCGAGATAATCCAGCTTAGCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003324.4-681s21c1
Sequence:CCGGCACAGTAAGATGTCGGATAATCTCGAGATTATCCGACATCTTACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003324.4-617s21c1
Sequence:CCGGATAACCTCCTGGGAGACATAGCTCGAGCTATGTCTCCCAGGAGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003324
TULP3 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 3
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003324.3-2286s1c1
Sequence:CCGGCCACGTATTATGTGACTCTTACTCGAGTAAGAGTCACATAATACGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-740s1c1
Sequence:CCGGCCTACTATATGTACTTGGAAACTCGAGTTTCCAAGTACATATAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-521s1c1
Sequence:CCGGCCCAGTCAGCATGTTTAGAAACTCGAGTTTCTAAACATGCTGACTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-844s1c1
Sequence:CCGGCCAGTTGATTTATCTCGTGAACTCGAGTTCACGAGATAAATCAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003324.3-151s1c1
Sequence:CCGGCGACAGGCTAAGCTGGATTATCTCGAGATAATCCAGCTTAGCCTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003324.4-681s21c1
Sequence:CCGGCACAGTAAGATGTCGGATAATCTCGAGATTATCCGACATCTTACTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417314    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003324.4-617s21c1
Sequence:CCGGATAACCTCCTGGGAGACATAGCTCGAGCTATGTCTCCCAGGAGGTTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011657
VALIDATED
TULP3 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 3
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000103508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-1306s1c1
Sequence:CCGGCGTGTTCACACTGGACTATAACTCGAGTTATAGTCCAGTGTGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011657.1-2826s1c1
Sequence:CCGGCCTACAGTGTACCTGAACTTACTCGAGTAAGTTCAGGTACACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-623s1c1
Sequence:CCGGGTGGAGAATTTAGAGGACTTTCTCGAGAAAGTCCTCTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-833s1c1
Sequence:CCGGCCGACAGATTTGTCTCGTGAACTCGAGTTCACGAGACAAATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011657.1-679s1c1
Sequence:CCGGGTGTAAAGTAACCAGGGATAACTCGAGTTATCCCTGGTTACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-890s21c1
Sequence:CCGGCCGACAGATTTGTCTCGTGAACTCGAGTTCACGAGACAAATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-680s21c1
Sequence:CCGGGTGGAGAATTTAGAGGACTTTCTCGAGAAAGTCCTCTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011657.2-2879s21c1
Sequence:CCGGCCTACAGTGTACCTGAACTTACTCGAGTAAGTTCAGGTACACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-736s21c1
Sequence:CCGGGTGTAAAGTAACCAGGGATAACTCGAGTTATCCCTGGTTACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011657
VALIDATED
TULP3 MISSION shRNA shRNA Plasmid DNA
tubby like protein 3
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000103508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-1306s1c1
Sequence:CCGGCGTGTTCACACTGGACTATAACTCGAGTTATAGTCCAGTGTGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011657.1-2826s1c1
Sequence:CCGGCCTACAGTGTACCTGAACTTACTCGAGTAAGTTCAGGTACACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-623s1c1
Sequence:CCGGGTGGAGAATTTAGAGGACTTTCTCGAGAAAGTCCTCTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-833s1c1
Sequence:CCGGCCGACAGATTTGTCTCGTGAACTCGAGTTCACGAGACAAATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011657.1-679s1c1
Sequence:CCGGGTGTAAAGTAACCAGGGATAACTCGAGTTATCCCTGGTTACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-890s21c1
Sequence:CCGGCCGACAGATTTGTCTCGTGAACTCGAGTTCACGAGACAAATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-680s21c1
Sequence:CCGGGTGGAGAATTTAGAGGACTTTCTCGAGAAAGTCCTCTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011657.2-2879s21c1
Sequence:CCGGCCTACAGTGTACCTGAACTTACTCGAGTAAGTTCAGGTACACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-736s21c1
Sequence:CCGGGTGTAAAGTAACCAGGGATAACTCGAGTTATCCCTGGTTACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011657
VALIDATED
TULP3 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 3
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000103508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-1306s1c1
Sequence:CCGGCGTGTTCACACTGGACTATAACTCGAGTTATAGTCCAGTGTGAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103505    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011657.1-2826s1c1
Sequence:CCGGCCTACAGTGTACCTGAACTTACTCGAGTAAGTTCAGGTACACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103507    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-623s1c1
Sequence:CCGGGTGGAGAATTTAGAGGACTTTCTCGAGAAAGTCCTCTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103506    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011657.1-833s1c1
Sequence:CCGGCCGACAGATTTGTCTCGTGAACTCGAGTTCACGAGACAAATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011657.1-679s1c1
Sequence:CCGGGTGTAAAGTAACCAGGGATAACTCGAGTTATCCCTGGTTACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-890s21c1
Sequence:CCGGCCGACAGATTTGTCTCGTGAACTCGAGTTCACGAGACAAATCTGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325575    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-680s21c1
Sequence:CCGGGTGGAGAATTTAGAGGACTTTCTCGAGAAAGTCCTCTAAATTCTCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325577    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011657.2-2879s21c1
Sequence:CCGGCCTACAGTGTACCTGAACTTACTCGAGTAAGTTCAGGTACACTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011657.2-736s21c1
Sequence:CCGGGTGTAAAGTAACCAGGGATAACTCGAGTTATCCCTGGTTACTTTACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks