EMAIL THIS PAGE TO A FRIEND

TULP4

tubby like protein 4

Synonyms: TUSP
UniProtKB ID: Q9NRJ4, Q5T3M2, Q5T3M3, Q9HD22, Q9P2F0
Gene ID:
Mouse(68842) tubby like protein 4
Rat(499016) tubby like protein 4
chicken(421658) tubby like protein 4
Horse(100059618) tubby like protein 4
domestic cat(101088242) tubby like protein 4
dog(484053) tubby like protein 4
naked mole-rat(101723273) tubby like protein 4
domestic guinea pig(100717736) tubby like protein 4
cow(100294795) tubby like protein 4
sheep(101109623) tubby like protein 4
125 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_054040 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_054040 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_054040 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020245 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020245 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020245 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001007466 Rosetta Predictions human pricing
NM_020245 Rosetta Predictions human pricing
NM_001109137 Rosetta Predictions rat pricing
NM_001103181 Rosetta Predictions mouse pricing
NM_054040 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00126604 predicted 2012
2 SASI_Hs01_00126605 predicted 1664
3 SASI_Hs01_00126606 predicted 2919
4 SASI_Hs01_00126607 predicted 1758
5 SASI_Hs01_00126608 predicted 1858
6 SASI_Hs01_00126609 predicted 1758
7 SASI_Hs01_00126610 predicted 1935
8 SASI_Hs01_00126611 predicted 2797
9 SASI_Hs01_00126612 predicted 2618
10 SASI_Hs01_00126613 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020245 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00134390 predicted 2012
2 SASI_Hs01_00134391 predicted 1668
3 SASI_Hs01_00134392 predicted 2917
4 SASI_Hs01_00134393 predicted 1755
5 SASI_Hs01_00134394 predicted 1856
6 SASI_Hs01_00134395 predicted 1759
7 SASI_Hs01_00134396 predicted 1928
8 SASI_Hs01_00134397 predicted 2797
9 SASI_Hs01_00134398 predicted 2615
10 SASI_Hs01_00134399 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109137 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00245490 predicted 3577
2 SASI_Rn02_00245491 predicted 1439
3 SASI_Rn02_00245492 predicted 1850
4 SASI_Rn02_00245493 predicted 501
5 SASI_Rn02_00245494 predicted 1991
6 SASI_Rn02_00245495 predicted 2841
7 SASI_Rn02_00245496 predicted 1368
8 SASI_Rn02_00245497 predicted 1544
9 SASI_Rn02_00245498 predicted 311
10 SASI_Rn02_00245499 predicted 1167
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001103181 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00303204 predicted 1458
2 SASI_Mm02_00303205 predicted 3487
3 SASI_Mm02_00303206 predicted 4417
4 SASI_Mm02_00303207 predicted 728
5 SASI_Mm02_00303208 predicted 1396
6 SASI_Mm02_00303209 predicted 1761
7 SASI_Mm02_00303210 predicted 883
8 SASI_Mm02_00303211 predicted 1138
9 SASI_Mm02_00303212 predicted 1075
10 SASI_Mm02_00303213 predicted 3574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_054040 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00170844 predicted 4337
2 SASI_Mm01_00170845 predicted 1255
3 SASI_Mm01_00170846 predicted 5259
4 SASI_Mm02_00337945 predicted 1577
5 SASI_Mm01_00170847 predicted 2244
6 SASI_Mm01_00170848 predicted 2605
7 SASI_Mm02_00337946 predicted 1721
8 SASI_Mm01_00170850 predicted 1988
9 SASI_Mm01_00170853 predicted 1922
10 SASI_Mm02_00337947 predicted 4410
11 SASI_Mm01_00170849 predicted 293
12 SASI_Mm01_00170851 predicted 456
13 SASI_Mm01_00170852 predicted 359
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_054040
VALIDATED
TULP4 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000374989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054040.3-1987s21c1
Sequence:CCGGTGCCTTCATTCCCACTATTAACTCGAGTTAATAGTGGGAATGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-2024s21c1
Sequence:CCGGCCCAACAACATGCGAGACTTTCTCGAGAAAGTCTCGCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-7965s21c1
Sequence:CCGGCCAGTCAATATCACTTGATTACTCGAGTAATCAAGTGATATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-1549s21c1
Sequence:CCGGCGGAGACATCAGCTTAATGAACTCGAGTTCATTAAGCTGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-1447s21c1
Sequence:CCGGTGACACTGACTCGGATGATTACTCGAGTAATCATCCGAGTCAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054040.1-7368s1c1
Sequence:CCGGCCAGTCAATATCACTTGATTACTCGAGTAATCAAGTGATATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-1428s1c1
Sequence:CCGGCCCAACAACATGCGAGACTTTCTCGAGAAAGTCTCGCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-470s1c1
Sequence:CCGGCGGAGGAATCTTTGTGTGGATCTCGAGATCCACACAAAGATTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-1601s1c1
Sequence:CCGGGCGGCCAGAGTTTGTCATTATCTCGAGATAATGACAAACTCTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000103454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-953s1c1
Sequence:CCGGCGGAGACATCAGCTTAATGAACTCGAGTTCATTAAGCTGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_054040
VALIDATED
TULP4 MISSION shRNA shRNA Plasmid DNA
tubby like protein 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000374989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054040.3-1987s21c1
Sequence:CCGGTGCCTTCATTCCCACTATTAACTCGAGTTAATAGTGGGAATGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-2024s21c1
Sequence:CCGGCCCAACAACATGCGAGACTTTCTCGAGAAAGTCTCGCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-7965s21c1
Sequence:CCGGCCAGTCAATATCACTTGATTACTCGAGTAATCAAGTGATATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-1549s21c1
Sequence:CCGGCGGAGACATCAGCTTAATGAACTCGAGTTCATTAAGCTGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-1447s21c1
Sequence:CCGGTGACACTGACTCGGATGATTACTCGAGTAATCATCCGAGTCAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054040.1-7368s1c1
Sequence:CCGGCCAGTCAATATCACTTGATTACTCGAGTAATCAAGTGATATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-1428s1c1
Sequence:CCGGCCCAACAACATGCGAGACTTTCTCGAGAAAGTCTCGCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-470s1c1
Sequence:CCGGCGGAGGAATCTTTGTGTGGATCTCGAGATCCACACAAAGATTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-1601s1c1
Sequence:CCGGGCGGCCAGAGTTTGTCATTATCTCGAGATAATGACAAACTCTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000103454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-953s1c1
Sequence:CCGGCGGAGACATCAGCTTAATGAACTCGAGTTCATTAAGCTGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_054040
VALIDATED
TULP4 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000374989    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_054040.3-1987s21c1
Sequence:CCGGTGCCTTCATTCCCACTATTAACTCGAGTTAATAGTGGGAATGAAGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302575    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-2024s21c1
Sequence:CCGGCCCAACAACATGCGAGACTTTCTCGAGAAAGTCTCGCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302574    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-7965s21c1
Sequence:CCGGCCAGTCAATATCACTTGATTACTCGAGTAATCAAGTGATATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302647    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-1549s21c1
Sequence:CCGGCGGAGACATCAGCTTAATGAACTCGAGTTCATTAAGCTGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374928    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_054040.3-1447s21c1
Sequence:CCGGTGACACTGACTCGGATGATTACTCGAGTAATCATCCGAGTCAGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103450    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_054040.1-7368s1c1
Sequence:CCGGCCAGTCAATATCACTTGATTACTCGAGTAATCAAGTGATATTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103451    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-1428s1c1
Sequence:CCGGCCCAACAACATGCGAGACTTTCTCGAGAAAGTCTCGCATGTTGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103452    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-470s1c1
Sequence:CCGGCGGAGGAATCTTTGTGTGGATCTCGAGATCCACACAAAGATTCCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103453    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-1601s1c1
Sequence:CCGGGCGGCCAGAGTTTGTCATTATCTCGAGATAATGACAAACTCTGGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000103454    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_054040.1-953s1c1
Sequence:CCGGCGGAGACATCAGCTTAATGAACTCGAGTTCATTAAGCTGATGTCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020245
VALIDATED
TULP4 MISSION shRNA Bacterial Glycerol Stock
tubby like protein 4
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020245.3-7152s21c1
Sequence:CCGGAGTGTTCACCAGGGTATTAAACTCGAGTTTAATACCCTGGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-4925s21c1
Sequence:CCGGCCATATCCAGGAAGCTATAACCTCGAGGTTATAGCTTCCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3831s21c1
Sequence:CCGGAGGTCCAGGTGACGAAGATAACTCGAGTTATCTTCGTCACCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3216s21c1
Sequence:CCGGACCTCGGTGCAGTAATCTATACTCGAGTATAGATTACTGCACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3143s21c1
Sequence:CCGGCTTGCTCAGGTCACGTCTAATCTCGAGATTAGACGTGACCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-5444s1c1
Sequence:CCGGGCTAGGACTTTGAGTGACTTTCTCGAGAAAGTCACTCAAAGTCCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-4895s1c1
Sequence:CCGGGCCACTTTCCAAACAGGCTATCTCGAGATAGCCTGTTTGGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-3323s1c1
Sequence:CCGGCCTGTCTTCAACCCAAATGTTCTCGAGAACATTTGGGTTGAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-5527s1c1
Sequence:CCGGCCAACTGAAGTCAAAGAAGTTCTCGAGAACTTCTTTGACTTCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000016975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-2624s1c1
Sequence:CCGGCCGAACAACATGAGAGACTTTCTCGAGAAAGTCTCTCATGTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020245
VALIDATED
TULP4 MISSION shRNA shRNA Plasmid DNA
tubby like protein 4
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020245.3-7152s21c1
Sequence:CCGGAGTGTTCACCAGGGTATTAAACTCGAGTTTAATACCCTGGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-4925s21c1
Sequence:CCGGCCATATCCAGGAAGCTATAACCTCGAGGTTATAGCTTCCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3831s21c1
Sequence:CCGGAGGTCCAGGTGACGAAGATAACTCGAGTTATCTTCGTCACCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3216s21c1
Sequence:CCGGACCTCGGTGCAGTAATCTATACTCGAGTATAGATTACTGCACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3143s21c1
Sequence:CCGGCTTGCTCAGGTCACGTCTAATCTCGAGATTAGACGTGACCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-5444s1c1
Sequence:CCGGGCTAGGACTTTGAGTGACTTTCTCGAGAAAGTCACTCAAAGTCCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-4895s1c1
Sequence:CCGGGCCACTTTCCAAACAGGCTATCTCGAGATAGCCTGTTTGGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-3323s1c1
Sequence:CCGGCCTGTCTTCAACCCAAATGTTCTCGAGAACATTTGGGTTGAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-5527s1c1
Sequence:CCGGCCAACTGAAGTCAAAGAAGTTCTCGAGAACTTCTTTGACTTCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000016975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-2624s1c1
Sequence:CCGGCCGAACAACATGAGAGACTTTCTCGAGAAAGTCTCTCATGTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020245
VALIDATED
TULP4 MISSION shRNA Lentiviral Transduction Particles
tubby like protein 4
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234615    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_020245.3-7152s21c1
Sequence:CCGGAGTGTTCACCAGGGTATTAAACTCGAGTTTAATACCCTGGTGAACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234614    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-4925s21c1
Sequence:CCGGCCATATCCAGGAAGCTATAACCTCGAGGTTATAGCTTCCTGGATATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234613    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3831s21c1
Sequence:CCGGAGGTCCAGGTGACGAAGATAACTCGAGTTATCTTCGTCACCTGGACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3216s21c1
Sequence:CCGGACCTCGGTGCAGTAATCTATACTCGAGTATAGATTACTGCACCGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020245.3-3143s21c1
Sequence:CCGGCTTGCTCAGGTCACGTCTAATCTCGAGATTAGACGTGACCTGAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016973    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-5444s1c1
Sequence:CCGGGCTAGGACTTTGAGTGACTTTCTCGAGAAAGTCACTCAAAGTCCTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-4895s1c1
Sequence:CCGGGCCACTTTCCAAACAGGCTATCTCGAGATAGCCTGTTTGGAAAGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-3323s1c1
Sequence:CCGGCCTGTCTTCAACCCAAATGTTCTCGAGAACATTTGGGTTGAAGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-5527s1c1
Sequence:CCGGCCAACTGAAGTCAAAGAAGTTCTCGAGAACTTCTTTGACTTCAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000016975    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020245.2-2624s1c1
Sequence:CCGGCCGAACAACATGAGAGACTTTCTCGAGAAAGTCTCTCATGTTGTTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks