EMAIL THIS PAGE TO A FRIEND

TUSC1

tumor suppressor candidate 1

Synonyms: TSG-9 TSG9
UniProtKB ID: Q2TAM9, A0PJ78, Q67GI3, Q86SS1, Q8TAH8
Gene ID:
Human(286319) Summary: This gene is located within the region of chromosome 9p that harbors tumor suppressor genes critical in carcinogenesis. It is an intronless gene which is downregulated in non-small-cell lung cancer and small-cell lung cancer cell lines, suggesting that it may play a role in lung tumorigenesis. [provided by RefSeq, Jul 2008]
Mouse(69136) tumor suppressor candidate 1
Rat(681254) tumor suppressor candidate 1
chicken(427361) tumor suppressor candidate 1
chicken(101667121) tumor suppressor candidate 1
chicken(101751372) tumor suppressor candidate 1
cow(539580) tumor suppressor candidate 1
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026954 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026954 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026954 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001004125 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001004125 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001004125 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU053381 MISSION® esiRNA esiRNA targeting mouse Tusc1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001004125 Rosetta Predictions human pricing
XM_001060960 Rosetta Predictions rat pricing
NM_026954 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004125 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026506 predicted 1089
2 SASI_Hs02_00304472 predicted 1602
3 SASI_Hs02_00304473 predicted 1626
4 SASI_Hs02_00304474 predicted 1631
5 SASI_Hs02_00304475 predicted 1482
6 SASI_Hs02_00304476 predicted 1494
7 SASI_Hs02_00304477 predicted 1567
8 SASI_Hs02_00304478 predicted 563
9 SASI_Hs02_00304479 predicted 1474
10 SASI_Hs02_00304480 predicted 1632
11 SASI_Hs01_00026504 predicted 997
12 SASI_Hs01_00026505 predicted 999
13 SASI_Hs01_00026507 predicted 1267
14 SASI_Hs01_00026508 predicted 1255
15 SASI_Hs01_00026509 predicted 1257
16 SASI_Hs01_00026510 predicted 995
17 SASI_Hs01_00026511 predicted 942
18 SASI_Hs01_00026512 predicted 916
19 SASI_Hs01_00026513 predicted 1264
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060960 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298282 predicted 240
2 SASI_Rn02_00298283 predicted 243
3 SASI_Rn02_00298284 predicted 263
4 SASI_Rn02_00298285 predicted 310
5 SASI_Rn02_00298286 predicted 320
6 SASI_Rn02_00298287 predicted 242
7 SASI_Rn02_00298288 predicted 255
8 SASI_Rn02_00298289 predicted 269
9 SASI_Rn02_00298290 predicted 261
10 SASI_Rn02_00298291 predicted 253
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026954 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00131730 predicted 478
2 SASI_Mm01_00131731 predicted 666
3 SASI_Mm01_00131732 predicted 830
4 SASI_Mm02_00331274 predicted 683
5 SASI_Mm01_00131733 predicted 537
6 SASI_Mm01_00131734 predicted 490
7 SASI_Mm01_00131735 predicted 459
8 SASI_Mm01_00131736 predicted 707
9 SASI_Mm01_00131737 predicted 657
10 SASI_Mm01_00131738 predicted 669
11 SASI_Mm01_00131729 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026954
TUSC1 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 1
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000203419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-961s1c1
Sequence:CCGGCCTGCTTTAAAGCAGCAAGAACTCGAGTTCTTGCTGCTTTAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000185209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-950s1c1
Sequence:CCGGCAACTCTAAGACCTGCTTTAACTCGAGTTAAAGCAGGTCTTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-995s1c1
Sequence:CCGGCGCACCTCCTAAATTCTTGAACTCGAGTTCAAGAATTTAGGAGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-1113s1c1
Sequence:CCGGGCCTGTTCATTCTACTGTCCACTCGAGTGGACAGTAGAATGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000203174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-866s1c1
Sequence:CCGGGAGAAAGAGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-989s21c1
Sequence:CCGGCCTGGTCGCACCTCCTAAATTCTCGAGAATTTAGGAGGTGCGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000204198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-901s1c1
Sequence:CCGGGTGCAAAGCAACTGCCAAGTACTCGAGTACTTGGCAGTTGCTTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-867s21c1
Sequence:CCGGAGAAAGAGAAGCAAGAGTTTCCTCGAGGAAACTCTTGCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-1081s21c1
Sequence:CCGGTTGAAGGATGAATAGTGTATTCTCGAGAATACACTATTCATCCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000254480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-950s21c1
Sequence:CCGGCAACTCTAAGACCTGCTTTAACTCGAGTTAAAGCAGGTCTTAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-1104s21c1
Sequence:CCGGATTGGTGATGCCTGTTCATTCCTCGAGGAATGAACAGGCATCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026954
TUSC1 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 1
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000203419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-961s1c1
Sequence:CCGGCCTGCTTTAAAGCAGCAAGAACTCGAGTTCTTGCTGCTTTAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000185209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-950s1c1
Sequence:CCGGCAACTCTAAGACCTGCTTTAACTCGAGTTAAAGCAGGTCTTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-995s1c1
Sequence:CCGGCGCACCTCCTAAATTCTTGAACTCGAGTTCAAGAATTTAGGAGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-1113s1c1
Sequence:CCGGGCCTGTTCATTCTACTGTCCACTCGAGTGGACAGTAGAATGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000203174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-866s1c1
Sequence:CCGGGAGAAAGAGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-989s21c1
Sequence:CCGGCCTGGTCGCACCTCCTAAATTCTCGAGAATTTAGGAGGTGCGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000204198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-901s1c1
Sequence:CCGGGTGCAAAGCAACTGCCAAGTACTCGAGTACTTGGCAGTTGCTTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-867s21c1
Sequence:CCGGAGAAAGAGAAGCAAGAGTTTCCTCGAGGAAACTCTTGCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-1081s21c1
Sequence:CCGGTTGAAGGATGAATAGTGTATTCTCGAGAATACACTATTCATCCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000254480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-950s21c1
Sequence:CCGGCAACTCTAAGACCTGCTTTAACTCGAGTTAAAGCAGGTCTTAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-1104s21c1
Sequence:CCGGATTGGTGATGCCTGTTCATTCCTCGAGGAATGAACAGGCATCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026954
TUSC1 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 1
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000203419    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-961s1c1
Sequence:CCGGCCTGCTTTAAAGCAGCAAGAACTCGAGTTCTTGCTGCTTTAAAGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000185209    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-950s1c1
Sequence:CCGGCAACTCTAAGACCTGCTTTAACTCGAGTTAAAGCAGGTCTTAGAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187068    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-995s1c1
Sequence:CCGGCGCACCTCCTAAATTCTTGAACTCGAGTTCAAGAATTTAGGAGGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187751    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-1113s1c1
Sequence:CCGGGCCTGTTCATTCTACTGTCCACTCGAGTGGACAGTAGAATGAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000203174    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-866s1c1
Sequence:CCGGGAGAAAGAGAAGCAAGAGTTTCTCGAGAAACTCTTGCTTCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265554    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-989s21c1
Sequence:CCGGCCTGGTCGCACCTCCTAAATTCTCGAGAATTTAGGAGGTGCGACCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000204198    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026954.1-901s1c1
Sequence:CCGGGTGCAAAGCAACTGCCAAGTACTCGAGTACTTGGCAGTTGCTTTGCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254481    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-867s21c1
Sequence:CCGGAGAAAGAGAAGCAAGAGTTTCCTCGAGGAAACTCTTGCTTCTCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254482    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-1081s21c1
Sequence:CCGGTTGAAGGATGAATAGTGTATTCTCGAGAATACACTATTCATCCTTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000254480    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-950s21c1
Sequence:CCGGCAACTCTAAGACCTGCTTTAACTCGAGTTAAAGCAGGTCTTAGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265560    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026954.1-1104s21c1
Sequence:CCGGATTGGTGATGCCTGTTCATTCCTCGAGGAATGAACAGGCATCACCAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001004125
TUSC1 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000078093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004125.1-1685s1c1
Sequence:CCGGCGGTGTTACTTGGATGTCCTACTCGAGTAGGACATCCAAGTAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-852s1c1
Sequence:CCGGGCAGCCTCTTCCGTCAGGCTTCTCGAGAAGCCTGACGGAAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-1099s1c1
Sequence:CCGGGCAGCCTCTACAGGAACCCGACTCGAGTCGGGTTCCTGTAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-936s1c1
Sequence:CCGGCCAGCACGAACCGGAGGGCTACTCGAGTAGCCCTCCGGTTCGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000078094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-1004s1c1
Sequence:CCGGGCCCGACTTGAGAAGCTGGAACTCGAGTTCCAGCTTCTCAAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001004125
TUSC1 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000078093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004125.1-1685s1c1
Sequence:CCGGCGGTGTTACTTGGATGTCCTACTCGAGTAGGACATCCAAGTAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-852s1c1
Sequence:CCGGGCAGCCTCTTCCGTCAGGCTTCTCGAGAAGCCTGACGGAAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-1099s1c1
Sequence:CCGGGCAGCCTCTACAGGAACCCGACTCGAGTCGGGTTCCTGTAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-936s1c1
Sequence:CCGGCCAGCACGAACCGGAGGGCTACTCGAGTAGCCCTCCGGTTCGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000078094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-1004s1c1
Sequence:CCGGGCCCGACTTGAGAAGCTGGAACTCGAGTTCCAGCTTCTCAAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001004125
TUSC1 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000078093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001004125.1-1685s1c1
Sequence:CCGGCGGTGTTACTTGGATGTCCTACTCGAGTAGGACATCCAAGTAACACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-852s1c1
Sequence:CCGGGCAGCCTCTTCCGTCAGGCTTCTCGAGAAGCCTGACGGAAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-1099s1c1
Sequence:CCGGGCAGCCTCTACAGGAACCCGACTCGAGTCGGGTTCCTGTAGAGGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-936s1c1
Sequence:CCGGCCAGCACGAACCGGAGGGCTACTCGAGTAGCCCTCCGGTTCGTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000078094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001004125.1-1004s1c1
Sequence:CCGGGCCCGACTTGAGAAGCTGGAACTCGAGTTCCAGCTTCTCAAGTCGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks