EMAIL THIS PAGE TO A FRIEND

TUSC2

tumor suppressor candidate 2

Synonyms: C3orf11 FUS1 PAP PDAP2
UniProtKB ID: O75896, B2R4Y9
Gene ID:
Human(11334) Summary: This gene is a highly conserved lung cancer candidate gene. No other information about this gene is currently available. [provided by RefSeq, Jul 2008]
Mouse(80385) tumor suppressor candidate 2
Rat(501052) tumor suppressor candidate 2
domestic guinea pig(100717029) tumor suppressor candidate 2
naked mole-rat(101709400) tumor suppressor candidate 2
cow(100848754) tumor suppressor candidate 2
sheep(101115409) tumor suppressor candidate 2
chicken(415910) tumor suppressor candidate 2
domestic cat(101094407) tumor suppressor candidate 2
dog(608576) tumor suppressor candidate 2
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_019742 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019742 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019742 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_007275 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007275 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007275 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU007821 MISSION® esiRNA esiRNA targeting mouse Tusc2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007275 Rosetta Predictions human pricing
NM_001109297 Rosetta Predictions rat pricing
NM_019742 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007275 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00125984 predicted 888
2 SASI_Hs01_00125988 predicted 902
3 SASI_Hs01_00125986 predicted 954
4 SASI_Hs01_00125987 predicted 324
5 SASI_Hs01_00125993 predicted 940
6 SASI_Hs01_00125989 predicted 737
7 SASI_Hs02_00343328 predicted 943
8 SASI_Hs02_00343329 predicted 450
9 SASI_Hs01_00125991 predicted 840
10 SASI_Hs01_00125992 predicted 751
11 SASI_Hs01_00125985 predicted 291
12 SASI_Hs01_00125990 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109297 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00247034 predicted 1334
2 SASI_Rn02_00247035 predicted 1042
3 SASI_Rn02_00247036 predicted 1036
4 SASI_Rn02_00247037 predicted 1039
5 SASI_Rn02_00247038 predicted 1037
6 SASI_Rn02_00247039 predicted 1095
7 SASI_Rn02_00247040 predicted 1299
8 SASI_Rn02_00247041 predicted 1142
9 SASI_Rn02_00247042 predicted 1227
10 SASI_Rn02_00247043 predicted 1041
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019742 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00324892 predicted 308
2 SASI_Mm01_00078955 predicted 933
3 SASI_Mm02_00324893 predicted 557
4 SASI_Mm01_00078957 predicted 634
5 SASI_Mm02_00324894 predicted 292
6 SASI_Mm02_00324895 predicted 351
7 SASI_Mm01_00078958 predicted 933
8 SASI_Mm01_00078959 predicted 846
9 SASI_Mm01_00078960 predicted 712
10 SASI_Mm01_00078961 predicted 557
11 SASI_Mm01_00078956 predicted 674
12 SASI_Mm01_00078962 predicted 534
13 SASI_Mm01_00078963 predicted 444
14 SASI_Mm01_00078964 predicted 952
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019742
VALIDATED
TUSC2 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 2
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-324s21c1
Sequence:CCGGTGAGGAGACAATCGTCACCAACTCGAGTTGGTGACGATTGTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-384s21c1
Sequence:CCGGGAATCTGATTCCTCAGGGCATCTCGAGATGCCCTGAGGAATCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-373s21c1
Sequence:CCGGCGGGTACATAAGAATCTGATTCTCGAGAATCAGATTCTTATGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-442s21c1
Sequence:CCGGCCCGTGATCCTCTATGAAGTACTCGAGTACTTCATAGAGGATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-385s1c1
Sequence:CCGGGAATCTGATTCCTCAGGGCATCTCGAGATGCCCTGAGGAATCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-373s1c1
Sequence:CCGGGCGGGTACATAAGAATCTGATCTCGAGATCAGATTCTTATGTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-398s1c1
Sequence:CCGGCAGGGCATCGTGAAGCTGGATCTCGAGATCCAGCTTCACGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-359s1c1
Sequence:CCGGCGAGCCAAGCTGAGGCGGGTACTCGAGTACCCGCCTCAGCTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-443s1c1
Sequence:CCGGCCCGTGATCCTCTATGAAGTACTCGAGTACTTCATAGAGGATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-275s1c1
Sequence:CCGGCGCGGCTCCATGTTCTACGATCTCGAGATCGTAGAACATGGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-329s1c1
Sequence:CCGGGAGACAATCGTCACCAAGAATCTCGAGATTCTTGGTGACGATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-316s1c1
Sequence:CCGGCGAATTCTATGAGGAGACAATCTCGAGATTGTCTCCTCATAGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-374s1c1
Sequence:CCGGCGGGTACATAAGAATCTGATTCTCGAGAATCAGATTCTTATGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-325s1c1
Sequence:CCGGTGAGGAGACAATCGTCACCAACTCGAGTTGGTGACGATTGTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019742
VALIDATED
TUSC2 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 2
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-324s21c1
Sequence:CCGGTGAGGAGACAATCGTCACCAACTCGAGTTGGTGACGATTGTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-384s21c1
Sequence:CCGGGAATCTGATTCCTCAGGGCATCTCGAGATGCCCTGAGGAATCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-373s21c1
Sequence:CCGGCGGGTACATAAGAATCTGATTCTCGAGAATCAGATTCTTATGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-442s21c1
Sequence:CCGGCCCGTGATCCTCTATGAAGTACTCGAGTACTTCATAGAGGATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-385s1c1
Sequence:CCGGGAATCTGATTCCTCAGGGCATCTCGAGATGCCCTGAGGAATCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-373s1c1
Sequence:CCGGGCGGGTACATAAGAATCTGATCTCGAGATCAGATTCTTATGTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-398s1c1
Sequence:CCGGCAGGGCATCGTGAAGCTGGATCTCGAGATCCAGCTTCACGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-359s1c1
Sequence:CCGGCGAGCCAAGCTGAGGCGGGTACTCGAGTACCCGCCTCAGCTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-443s1c1
Sequence:CCGGCCCGTGATCCTCTATGAAGTACTCGAGTACTTCATAGAGGATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-275s1c1
Sequence:CCGGCGCGGCTCCATGTTCTACGATCTCGAGATCGTAGAACATGGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-329s1c1
Sequence:CCGGGAGACAATCGTCACCAAGAATCTCGAGATTCTTGGTGACGATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-316s1c1
Sequence:CCGGCGAATTCTATGAGGAGACAATCTCGAGATTGTCTCCTCATAGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-374s1c1
Sequence:CCGGCGGGTACATAAGAATCTGATTCTCGAGAATCAGATTCTTATGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-325s1c1
Sequence:CCGGTGAGGAGACAATCGTCACCAACTCGAGTTGGTGACGATTGTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019742
VALIDATED
TUSC2 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 2
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363824    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-324s21c1
Sequence:CCGGTGAGGAGACAATCGTCACCAACTCGAGTTGGTGACGATTGTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334573    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-384s21c1
Sequence:CCGGGAATCTGATTCCTCAGGGCATCTCGAGATGCCCTGAGGAATCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333995    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-373s21c1
Sequence:CCGGCGGGTACATAAGAATCTGATTCTCGAGAATCAGATTCTTATGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363693    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_019742.4-442s21c1
Sequence:CCGGCCCGTGATCCTCTATGAAGTACTCGAGTACTTCATAGAGGATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055008    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-385s1c1
Sequence:CCGGGAATCTGATTCCTCAGGGCATCTCGAGATGCCCTGAGGAATCAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055009    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-373s1c1
Sequence:CCGGGCGGGTACATAAGAATCTGATCTCGAGATCAGATTCTTATGTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055010    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-398s1c1
Sequence:CCGGCAGGGCATCGTGAAGCTGGATCTCGAGATCCAGCTTCACGATGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055012    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-359s1c1
Sequence:CCGGCGAGCCAAGCTGAGGCGGGTACTCGAGTACCCGCCTCAGCTTGGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042449    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-443s1c1
Sequence:CCGGCCCGTGATCCTCTATGAAGTACTCGAGTACTTCATAGAGGATCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042451    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-275s1c1
Sequence:CCGGCGCGGCTCCATGTTCTACGATCTCGAGATCGTAGAACATGGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042452    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-329s1c1
Sequence:CCGGGAGACAATCGTCACCAAGAATCTCGAGATTCTTGGTGACGATTGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042450    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-316s1c1
Sequence:CCGGCGAATTCTATGAGGAGACAATCTCGAGATTGTCTCCTCATAGAATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042448    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-374s1c1
Sequence:CCGGCGGGTACATAAGAATCTGATTCTCGAGAATCAGATTCTTATGTACCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055011    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_019742.2-325s1c1
Sequence:CCGGTGAGGAGACAATCGTCACCAACTCGAGTTGGTGACGATTGTCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007275
VALIDATED
TUSC2 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-451s21c1
Sequence:CCGGGATTTCCCTGTGATCCTCTATCTCGAGATAGAGGATCACAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-289s21c1
Sequence:CCGGCGCGGCTCTATGTTCTATGATCTCGAGATCATAGAACATAGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-388s21c1
Sequence:CCGGCGAGTGCATAAGAATCTGATTCTCGAGAATCAGATTCTTATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-319s21c1
Sequence:CCGGGATCTGGCTCACGAGTTCTATCTCGAGATAGAACTCGTGAGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007275.1-633s1c1
Sequence:CCGGCCACAGTATTGGTTGGGTGTTCTCGAGAACACCCAACCAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-388s1c1
Sequence:CCGGCGAGTGCATAAGAATCTGATTCTCGAGAATCAGATTCTTATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007275.1-319s1c1
Sequence:CCGGGATCTGGCTCACGAGTTCTATCTCGAGATAGAACTCGTGAGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-451s1c1
Sequence:CCGGGATTTCCCTGTGATCCTCTATCTCGAGATAGAGGATCACAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-289s1c1
Sequence:CCGGCGCGGCTCTATGTTCTATGATCTCGAGATCATAGAACATAGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007275
VALIDATED
TUSC2 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-451s21c1
Sequence:CCGGGATTTCCCTGTGATCCTCTATCTCGAGATAGAGGATCACAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-289s21c1
Sequence:CCGGCGCGGCTCTATGTTCTATGATCTCGAGATCATAGAACATAGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-388s21c1
Sequence:CCGGCGAGTGCATAAGAATCTGATTCTCGAGAATCAGATTCTTATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-319s21c1
Sequence:CCGGGATCTGGCTCACGAGTTCTATCTCGAGATAGAACTCGTGAGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007275.1-633s1c1
Sequence:CCGGCCACAGTATTGGTTGGGTGTTCTCGAGAACACCCAACCAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-388s1c1
Sequence:CCGGCGAGTGCATAAGAATCTGATTCTCGAGAATCAGATTCTTATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007275.1-319s1c1
Sequence:CCGGGATCTGGCTCACGAGTTCTATCTCGAGATAGAACTCGTGAGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-451s1c1
Sequence:CCGGGATTTCCCTGTGATCCTCTATCTCGAGATAGAGGATCACAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-289s1c1
Sequence:CCGGCGCGGCTCTATGTTCTATGATCTCGAGATCATAGAACATAGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007275
VALIDATED
TUSC2 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299120    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-451s21c1
Sequence:CCGGGATTTCCCTGTGATCCTCTATCTCGAGATAGAGGATCACAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299119    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-289s21c1
Sequence:CCGGCGCGGCTCTATGTTCTATGATCTCGAGATCATAGAACATAGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-388s21c1
Sequence:CCGGCGAGTGCATAAGAATCTGATTCTCGAGAATCAGATTCTTATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007275.1-319s21c1
Sequence:CCGGGATCTGGCTCACGAGTTCTATCTCGAGATAGAACTCGTGAGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038084    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007275.1-633s1c1
Sequence:CCGGCCACAGTATTGGTTGGGTGTTCTCGAGAACACCCAACCAATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-388s1c1
Sequence:CCGGCGAGTGCATAAGAATCTGATTCTCGAGAATCAGATTCTTATGCACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007275.1-319s1c1
Sequence:CCGGGATCTGGCTCACGAGTTCTATCTCGAGATAGAACTCGTGAGCCAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-451s1c1
Sequence:CCGGGATTTCCCTGTGATCCTCTATCTCGAGATAGAGGATCACAGGGAAATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_007275.1-289s1c1
Sequence:CCGGCGCGGCTCTATGTTCTATGATCTCGAGATCATAGAACATAGAGCCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks