EMAIL THIS PAGE TO A FRIEND

TUSC3

tumor suppressor candidate 3

Synonyms: D8S1992 M33 MRT22 MRT7 N33 OST3A
UniProtKB ID: Q13454, A8MSM0, D3DSP2, Q14911, Q14912, Q96FW0
Gene ID:
Human(7991) Summary: This gene is a candidate tumor suppressor gene. It is located within a homozygously deleted region of a metastatic prostate cancer. The gene is expressed in most nonlymphoid human tissues including prostate, lung, liver, and colon. Expression was also detected in many epithelial tumor cell lines. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(80286) tumor suppressor candidate 3
Rat(290783) tumor suppressor candidate 3
Zebrafish(553582) tumor suppressor candidate 3
domestic cat(101081724) tumor suppressor candidate 3
Horse(100049974) tumor suppressor candidate 3
dog(475608) tumor suppressor candidate 3
chicken(422738) tumor suppressor candidate 3
cow(615007) tumor suppressor candidate 3
sheep(101112376) tumor suppressor candidate 3
naked mole-rat(101697973) tumor suppressor candidate 3
domestic guinea pig(100731284) tumor suppressor candidate 3
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006765 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006765 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006765 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006765 Rosetta Predictions human pricing
NM_178234 Rosetta Predictions human pricing
NM_001004212 Rosetta Predictions rat pricing
NM_030254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006765 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00102620 predicted 641
2 SASI_Hs02_00342264 predicted 394
3 SASI_Hs01_00102622 predicted 836
4 SASI_Hs02_00342265 predicted 835
5 SASI_Hs01_00102628 predicted 968
6 SASI_Hs02_00342266 predicted 789
7 SASI_Hs02_00342267 predicted 817
8 SASI_Hs02_00342268 predicted 993
9 SASI_Hs02_00342269 predicted 403
10 SASI_Hs01_00102621 predicted 908
11 SASI_Hs01_00102623 predicted 763
12 SASI_Hs01_00102624 predicted 862
13 SASI_Hs01_00102625 predicted 765
14 SASI_Hs01_00102626 predicted 384
15 SASI_Hs01_00102627 predicted 687
16 SASI_Hs01_00102629 predicted 520
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178234 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025937 predicted 635
2 SASI_Hs01_00025938 predicted 393
3 SASI_Hs02_00369610 predicted 837
4 SASI_Hs02_00369611 predicted 828
5 SASI_Hs02_00369612 predicted 963
6 SASI_Hs01_00025945 predicted 794
7 SASI_Hs02_00369613 predicted 815
8 SASI_Hs02_00369614 predicted 992
9 SASI_Hs02_00369615 predicted 405
10 SASI_Hs02_00369616 predicted 915
11 SASI_Hs01_00025939 predicted 755
12 SASI_Hs01_00025940 predicted 763
13 SASI_Hs01_00025941 predicted 380
14 SASI_Hs01_00025942 predicted 690
15 SASI_Hs01_00025943 predicted 518
16 SASI_Hs01_00025944 predicted 691
17 SASI_Hs01_00025946 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004212 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064270 predicted 841
2 SASI_Rn01_00064271 predicted 515
3 SASI_Rn01_00064272 predicted 1024
4 SASI_Rn01_00064273 predicted 673
5 SASI_Rn01_00064274 predicted 575
6 SASI_Rn01_00064275 predicted 740
7 SASI_Rn01_00064277 predicted 581
8 SASI_Rn01_00064278 predicted 1169
9 SASI_Rn02_00198196 predicted 676
10 SASI_Rn02_00198197 predicted 775
11 SASI_Rn01_00064269 predicted 623
12 SASI_Rn01_00064276 predicted 686
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047592 predicted 401
2 SASI_Mm01_00047593 predicted 525
3 SASI_Mm02_00336723 predicted 440
4 SASI_Mm02_00336724 predicted 1239
5 SASI_Mm02_00336725 predicted 584
6 SASI_Mm01_00047585 predicted 696
7 SASI_Mm02_00336726 predicted 1177
8 SASI_Mm01_00047586 predicted 744
9 SASI_Mm02_00336727 predicted 1182
10 SASI_Mm01_00047587 predicted 894
11 SASI_Mm01_00047584 predicted 1301
12 SASI_Mm01_00047588 predicted 603
13 SASI_Mm01_00047589 predicted 758
14 SASI_Mm01_00047590 predicted 772
15 SASI_Mm01_00047591 predicted 944
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030254
VALIDATED
TUSC3 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 3
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-729s1c1
Sequence:CCGGCGGATGTTCATATTCGAGTTTCTCGAGAAACTCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-516s1c1
Sequence:CCGGCCTGGCGTTATTCATCTGCTTCTCGAGAAGCAGATGAATAACGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-367s1c1
Sequence:CCGGCTTCAGAATGAACGGCGACAACTCGAGTTGTCGCCGTTCATTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-1007s1c1
Sequence:CCGGGCAGAGTCACACATCATTCTACTCGAGTAGAATGATGTGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030254.2-814s1c1
Sequence:CCGGGCTTTATCTAAGGAGGAACAACTCGAGTTGTTCCTCCTTAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-391s21c1
Sequence:CCGGCTTCAGAATGAACGGCGACAACTCGAGTTGTCGCCGTTCATTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-540s21c1
Sequence:CCGGCCTGGCGTTATTCATCTGCTTCTCGAGAAGCAGATGAATAACGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-1031s21c1
Sequence:CCGGGCAGAGTCACACATCATTCTACTCGAGTAGAATGATGTGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-753s21c1
Sequence:CCGGCGGATGTTCATATTCGAGTTTCTCGAGAAACTCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000324734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-838s21c1
Sequence:CCGGGCTTTATCTAAGGAGGAACAACTCGAGTTGTTCCTCCTTAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030254
VALIDATED
TUSC3 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 3
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-729s1c1
Sequence:CCGGCGGATGTTCATATTCGAGTTTCTCGAGAAACTCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-516s1c1
Sequence:CCGGCCTGGCGTTATTCATCTGCTTCTCGAGAAGCAGATGAATAACGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-367s1c1
Sequence:CCGGCTTCAGAATGAACGGCGACAACTCGAGTTGTCGCCGTTCATTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-1007s1c1
Sequence:CCGGGCAGAGTCACACATCATTCTACTCGAGTAGAATGATGTGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030254.2-814s1c1
Sequence:CCGGGCTTTATCTAAGGAGGAACAACTCGAGTTGTTCCTCCTTAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-391s21c1
Sequence:CCGGCTTCAGAATGAACGGCGACAACTCGAGTTGTCGCCGTTCATTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-540s21c1
Sequence:CCGGCCTGGCGTTATTCATCTGCTTCTCGAGAAGCAGATGAATAACGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-1031s21c1
Sequence:CCGGGCAGAGTCACACATCATTCTACTCGAGTAGAATGATGTGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-753s21c1
Sequence:CCGGCGGATGTTCATATTCGAGTTTCTCGAGAAACTCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000324734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-838s21c1
Sequence:CCGGGCTTTATCTAAGGAGGAACAACTCGAGTTGTTCCTCCTTAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030254
VALIDATED
TUSC3 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 3
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042443    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-729s1c1
Sequence:CCGGCGGATGTTCATATTCGAGTTTCTCGAGAAACTCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-516s1c1
Sequence:CCGGCCTGGCGTTATTCATCTGCTTCTCGAGAAGCAGATGAATAACGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-367s1c1
Sequence:CCGGCTTCAGAATGAACGGCGACAACTCGAGTTGTCGCCGTTCATTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042446    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_030254.2-1007s1c1
Sequence:CCGGGCAGAGTCACACATCATTCTACTCGAGTAGAATGATGTGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042444    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030254.2-814s1c1
Sequence:CCGGGCTTTATCTAAGGAGGAACAACTCGAGTTGTTCCTCCTTAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-391s21c1
Sequence:CCGGCTTCAGAATGAACGGCGACAACTCGAGTTGTCGCCGTTCATTCTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324735    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-540s21c1
Sequence:CCGGCCTGGCGTTATTCATCTGCTTCTCGAGAAGCAGATGAATAACGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-1031s21c1
Sequence:CCGGGCAGAGTCACACATCATTCTACTCGAGTAGAATGATGTGTGACTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-753s21c1
Sequence:CCGGCGGATGTTCATATTCGAGTTTCTCGAGAAACTCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000324734    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030254.3-838s21c1
Sequence:CCGGGCTTTATCTAAGGAGGAACAACTCGAGTTGTTCCTCCTTAGATAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006765
VALIDATED
TUSC3 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-555s1c1
Sequence:CCGGCTGGCGCTATTCATCTGCTTTCTCGAGAAAGCAGATGAATAGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-1054s1c1
Sequence:CCGGCACATTATTCTGGTACTGAATCTCGAGATTCAGTACCAGAATAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006765.2-979s1c1
Sequence:CCGGGCTCATAAGAACCCACACAATCTCGAGATTGTGTGGGTTCTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-451s1c1
Sequence:CCGGCCTCGAAACTATTCCATGATTCTCGAGAATCATGGAATAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-767s1c1
Sequence:CCGGCGGATGTTCATATTCGGGTTTCTCGAGAAACCCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-979s21c1
Sequence:CCGGGCTCATAAGAACCCACACAATCTCGAGATTGTGTGGGTTCTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-767s21c1
Sequence:CCGGCGGATGTTCATATTCGGGTTTCTCGAGAAACCCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-451s21c1
Sequence:CCGGCCTCGAAACTATTCCATGATTCTCGAGAATCATGGAATAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-555s21c1
Sequence:CCGGCTGGCGCTATTCATCTGCTTTCTCGAGAAAGCAGATGAATAGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-1054s21c1
Sequence:CCGGCACATTATTCTGGTACTGAATCTCGAGATTCAGTACCAGAATAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006765
VALIDATED
TUSC3 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-555s1c1
Sequence:CCGGCTGGCGCTATTCATCTGCTTTCTCGAGAAAGCAGATGAATAGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-1054s1c1
Sequence:CCGGCACATTATTCTGGTACTGAATCTCGAGATTCAGTACCAGAATAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006765.2-979s1c1
Sequence:CCGGGCTCATAAGAACCCACACAATCTCGAGATTGTGTGGGTTCTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-451s1c1
Sequence:CCGGCCTCGAAACTATTCCATGATTCTCGAGAATCATGGAATAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-767s1c1
Sequence:CCGGCGGATGTTCATATTCGGGTTTCTCGAGAAACCCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-979s21c1
Sequence:CCGGGCTCATAAGAACCCACACAATCTCGAGATTGTGTGGGTTCTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-767s21c1
Sequence:CCGGCGGATGTTCATATTCGGGTTTCTCGAGAAACCCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-451s21c1
Sequence:CCGGCCTCGAAACTATTCCATGATTCTCGAGAATCATGGAATAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-555s21c1
Sequence:CCGGCTGGCGCTATTCATCTGCTTTCTCGAGAAAGCAGATGAATAGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-1054s21c1
Sequence:CCGGCACATTATTCTGGTACTGAATCTCGAGATTCAGTACCAGAATAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006765
VALIDATED
TUSC3 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038068    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-555s1c1
Sequence:CCGGCTGGCGCTATTCATCTGCTTTCTCGAGAAAGCAGATGAATAGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-1054s1c1
Sequence:CCGGCACATTATTCTGGTACTGAATCTCGAGATTCAGTACCAGAATAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006765.2-979s1c1
Sequence:CCGGGCTCATAAGAACCCACACAATCTCGAGATTGTGTGGGTTCTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-451s1c1
Sequence:CCGGCCTCGAAACTATTCCATGATTCTCGAGAATCATGGAATAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_006765.2-767s1c1
Sequence:CCGGCGGATGTTCATATTCGGGTTTCTCGAGAAACCCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299038    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-979s21c1
Sequence:CCGGGCTCATAAGAACCCACACAATCTCGAGATTGTGTGGGTTCTTATGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299039    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-767s21c1
Sequence:CCGGCGGATGTTCATATTCGGGTTTCTCGAGAAACCCGAATATGAACATCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-451s21c1
Sequence:CCGGCCTCGAAACTATTCCATGATTCTCGAGAATCATGGAATAGTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-555s21c1
Sequence:CCGGCTGGCGCTATTCATCTGCTTTCTCGAGAAAGCAGATGAATAGCGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_006765.2-1054s21c1
Sequence:CCGGCACATTATTCTGGTACTGAATCTCGAGATTCAGTACCAGAATAATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks