EMAIL THIS PAGE TO A FRIEND

TUSC5

tumor suppressor candidate 5

Synonyms: DSPB1 IFITMD3 LOST1
UniProtKB ID: Q8IXB3, A6NMK4
Gene ID:
Mouse(237858) tumor suppressor candidate 5
Rat(360576) tumor suppressor candidate 5
domestic guinea pig(100721796) tumor suppressor candidate 5
naked mole-rat(101707515) tumor suppressor candidate 5
cow(527604) tumor suppressor candidate 5
sheep(101112744) tumor suppressor candidate 5
domestic cat(101081511) tumor suppressor candidate 5
dog(491186) tumor suppressor candidate 5
97 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_177709 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177709 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177709 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172367 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172367 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172367 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172367 Rosetta Predictions human pricing
NM_001039163 Rosetta Predictions rat pricing
NM_177709 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172367 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368019 predicted 702
2 SASI_Hs01_00080867 predicted 1079
3 SASI_Hs01_00080868 predicted 1076
4 SASI_Hs01_00080869 predicted 1253
5 SASI_Hs01_00080870 predicted 792
6 SASI_Hs01_00080871 predicted 1136
7 SASI_Hs01_00080872 predicted 1067
8 SASI_Hs01_00080873 predicted 354
9 SASI_Hs02_00368020 predicted 1138
10 SASI_Hs01_00080874 predicted 724
11 SASI_Hs01_00080875 predicted 864
12 SASI_Hs01_00080876 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039163 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068623 predicted 1321
2 SASI_Rn01_00068624 predicted 811
3 SASI_Rn01_00068625 predicted 1253
4 SASI_Rn02_00204801 predicted 1168
5 SASI_Rn02_00204802 predicted 1459
6 SASI_Rn01_00068626 predicted 1436
7 SASI_Rn01_00068627 predicted 903
8 SASI_Rn01_00068628 predicted 1094
9 SASI_Rn01_00068629 predicted 1180
10 SASI_Rn01_00068630 predicted 1131
11 SASI_Rn01_00068631 predicted 1245
12 SASI_Rn01_00068632 predicted 1395
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177709 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115168 predicted 1290
2 SASI_Mm01_00115170 predicted 1005
3 SASI_Mm01_00115171 predicted 747
4 SASI_Mm01_00115172 predicted 935
5 SASI_Mm01_00115173 predicted 532
6 SASI_Mm01_00115174 predicted 1074
7 SASI_Mm02_00348051 predicted 348
8 SASI_Mm01_00115175 predicted 1024
9 SASI_Mm01_00115176 predicted 385
10 SASI_Mm01_00115177 predicted 725
11 SASI_Mm01_00115169 predicted 1073
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177709
TUSC5 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 5
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000042473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177709.2-1091s1c1
Sequence:CCGGCGTAGCGTAAACTGCCAGAATCTCGAGATTCTGGCAGTTTACGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-728s1c1
Sequence:CCGGGCTACTCAGCATCACCTTCATCTCGAGATGAAGGTGATGCTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-345s1c1
Sequence:CCGGCTGCCTGAGATGGAGAAACTACTCGAGTAGTTTCTCCATCTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-752s1c1
Sequence:CCGGCCTGGGCATCGTTATCATCATCTCGAGATGATGATAACGATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000042474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-579s1c1
Sequence:CCGGCCCAAAGATTACCTGGTCCTTCTCGAGAAGGACCAGGTAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177709
TUSC5 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 5
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000042473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177709.2-1091s1c1
Sequence:CCGGCGTAGCGTAAACTGCCAGAATCTCGAGATTCTGGCAGTTTACGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-728s1c1
Sequence:CCGGGCTACTCAGCATCACCTTCATCTCGAGATGAAGGTGATGCTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-345s1c1
Sequence:CCGGCTGCCTGAGATGGAGAAACTACTCGAGTAGTTTCTCCATCTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-752s1c1
Sequence:CCGGCCTGGGCATCGTTATCATCATCTCGAGATGATGATAACGATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000042474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-579s1c1
Sequence:CCGGCCCAAAGATTACCTGGTCCTTCTCGAGAAGGACCAGGTAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177709
TUSC5 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 5
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000042473    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177709.2-1091s1c1
Sequence:CCGGCGTAGCGTAAACTGCCAGAATCTCGAGATTCTGGCAGTTTACGCTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-728s1c1
Sequence:CCGGGCTACTCAGCATCACCTTCATCTCGAGATGAAGGTGATGCTGAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042476    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-345s1c1
Sequence:CCGGCTGCCTGAGATGGAGAAACTACTCGAGTAGTTTCTCCATCTCAGGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042477    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-752s1c1
Sequence:CCGGCCTGGGCATCGTTATCATCATCTCGAGATGATGATAACGATGCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000042474    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177709.2-579s1c1
Sequence:CCGGCCCAAAGATTACCTGGTCCTTCTCGAGAAGGACCAGGTAATCTTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172367
TUSC5 MISSION shRNA Bacterial Glycerol Stock
tumor suppressor candidate 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000038120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-846s1c1
Sequence:CCGGCGTCAACTTCACAGTTCAGAACTCGAGTTCTGAACTGTGAAGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-459s1c1
Sequence:CCGGCCTGAATCTGTCCAAGACCCTCTCGAGAGGGTCTTGGACAGATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-822s1c1
Sequence:CCGGCGTCATTATCATGGTGGCCGTCTCGAGACGGCCACCATGATAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-720s1c1
Sequence:CCGGCATCATGTCTCGAAGCAGCATCTCGAGATGCTGCTTCGAGACATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000038119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-792s1c1
Sequence:CCGGGCTCAGCATTACCCTCATCATCTCGAGATGATGAGGGTAATGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172367
TUSC5 MISSION shRNA shRNA Plasmid DNA
tumor suppressor candidate 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000038120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-846s1c1
Sequence:CCGGCGTCAACTTCACAGTTCAGAACTCGAGTTCTGAACTGTGAAGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-459s1c1
Sequence:CCGGCCTGAATCTGTCCAAGACCCTCTCGAGAGGGTCTTGGACAGATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-822s1c1
Sequence:CCGGCGTCATTATCATGGTGGCCGTCTCGAGACGGCCACCATGATAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-720s1c1
Sequence:CCGGCATCATGTCTCGAAGCAGCATCTCGAGATGCTGCTTCGAGACATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000038119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-792s1c1
Sequence:CCGGGCTCAGCATTACCCTCATCATCTCGAGATGATGAGGGTAATGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172367
TUSC5 MISSION shRNA Lentiviral Transduction Particles
tumor suppressor candidate 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000038120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-846s1c1
Sequence:CCGGCGTCAACTTCACAGTTCAGAACTCGAGTTCTGAACTGTGAAGTTGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-459s1c1
Sequence:CCGGCCTGAATCTGTCCAAGACCCTCTCGAGAGGGTCTTGGACAGATTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038123    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-822s1c1
Sequence:CCGGCGTCATTATCATGGTGGCCGTCTCGAGACGGCCACCATGATAATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-720s1c1
Sequence:CCGGCATCATGTCTCGAAGCAGCATCTCGAGATGCTGCTTCGAGACATGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000038119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172367.1-792s1c1
Sequence:CCGGGCTCAGCATTACCCTCATCATCTCGAGATGATGAGGGTAATGCTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks