EMAIL THIS PAGE TO A FRIEND

TUT1

terminal uridylyl transferase 1, U6 snRNA-specific

Synonyms: PAPD2 RBM21 STARPAP TUTase
UniProtKB ID: Q9H6E5, A1A527, A8K995, Q2NL65, Q7L583, Q9H6H7
Gene ID:
Human(64852) Summary: This gene encodes a nucleotidyl transferase that functions as both a terminal uridylyltransferase and a nuclear poly(A) polymerase. The encoded enzyme specifically adds and removes nucleotides from the 3' end of small nuclear RNAs and select mRNAs and may function in controlling gene expression and cell proliferation.[provided by RefSeq, Apr 2009]
Mouse(70044) terminal uridylyl transferase 1, U6 snRNA-specific
Rat(499314) terminal uridylyl transferase 1, U6 snRNA-specific
Zebrafish(564388) terminal uridylyl transferase 1, U6 snRNA-specific
chicken(430595) terminal uridylyl transferase 1, U6 snRNA-specific
dog(476058) terminal uridylyl transferase 1, U6 snRNA-specific
Horse(100060118) terminal uridylyl transferase 1, U6 snRNA-specific
domestic cat(101088273) terminal uridylyl transferase 1, U6 snRNA-specific
cow(616339) terminal uridylyl transferase 1, U6 snRNA-specific
sheep(101111503) terminal uridylyl transferase 1, U6 snRNA-specific
naked mole-rat(101716868) terminal uridylyl transferase 1, U6 snRNA-specific
Domestic Rabbit(100340096) terminal uridylyl transferase 1, U6 snRNA-specific
domestic guinea pig(100735637) terminal uridylyl transferase 1, U6 snRNA-specific
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_022830 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022830 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022830 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_197993 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_197993 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_197993 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022830 Rosetta Predictions human pricing
NM_001033901 Rosetta Predictions rat pricing
NM_197993 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022830 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026117 predicted 324
2 SASI_Hs01_00026119 predicted 2034
3 SASI_Hs01_00026120 predicted 700
4 SASI_Hs01_00026121 predicted 1188
5 SASI_Hs01_00026122 predicted 685
6 SASI_Hs01_00026123 predicted 1542
7 SASI_Hs02_00356134 predicted 283
8 SASI_Hs01_00026124 predicted 219
9 SASI_Hs01_00026125 predicted 1550
10 SASI_Hs02_00356135 predicted 2119
11 SASI_Hs01_00026118 predicted 278
12 SASI_Hs01_00026126 predicted 256
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033901 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074426 predicted 1495
2 SASI_Rn01_00074427 predicted 428
3 SASI_Rn02_00203808 predicted 637
4 SASI_Rn01_00074428 predicted 1869
5 SASI_Rn01_00074429 predicted 1023
6 SASI_Rn01_00074430 predicted 489
7 SASI_Rn01_00074431 predicted 255
8 SASI_Rn01_00074432 predicted 1409
9 SASI_Rn01_00074433 predicted 1157
10 SASI_Rn01_00074434 predicted 2329
11 SASI_Rn01_00074435 predicted 2096
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_197993 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00060877 predicted 1594
2 SASI_Mm01_00060878 predicted 1245
3 SASI_Mm01_00060879 predicted 1520
4 SASI_Mm01_00060880 predicted 1115
5 SASI_Mm01_00060881 predicted 1280
6 SASI_Mm01_00060882 predicted 334
7 SASI_Mm01_00060883 predicted 298
8 SASI_Mm01_00060884 predicted 1256
9 SASI_Mm01_00060885 predicted 701
10 SASI_Mm01_00060886 predicted 1236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022830
TUT1 MISSION shRNA Bacterial Glycerol Stock
terminal uridylyl transferase 1, U6 snRNA-specific
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000129603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-216s1c1
Sequence:CCGGCAGGGACTTCGAAGTGTGTTTCTCGAGAAACACACTTCGAAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-1359s1c1
Sequence:CCGGCTGACCTTGCTGGTGATCTATCTCGAGATAGATCACCAGCAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-705s1c1
Sequence:CCGGGATCTTGACCTCTTCTTGGATCTCGAGATCCAAGAAGAGGTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-2040s1c1
Sequence:CCGGCTCAAAGTAGATGGACAGAAACTCGAGTTTCTGTCCATCTACTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022830.1-1958s1c1
Sequence:CCGGCCATATAGAACAGGCAACCAACTCGAGTTGGTTGCCTGTTCTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022830
TUT1 MISSION shRNA shRNA Plasmid DNA
terminal uridylyl transferase 1, U6 snRNA-specific
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000129603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-216s1c1
Sequence:CCGGCAGGGACTTCGAAGTGTGTTTCTCGAGAAACACACTTCGAAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-1359s1c1
Sequence:CCGGCTGACCTTGCTGGTGATCTATCTCGAGATAGATCACCAGCAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-705s1c1
Sequence:CCGGGATCTTGACCTCTTCTTGGATCTCGAGATCCAAGAAGAGGTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-2040s1c1
Sequence:CCGGCTCAAAGTAGATGGACAGAAACTCGAGTTTCTGTCCATCTACTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022830.1-1958s1c1
Sequence:CCGGCCATATAGAACAGGCAACCAACTCGAGTTGGTTGCCTGTTCTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022830
TUT1 MISSION shRNA Lentiviral Transduction Particles
terminal uridylyl transferase 1, U6 snRNA-specific
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000129603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-216s1c1
Sequence:CCGGCAGGGACTTCGAAGTGTGTTTCTCGAGAAACACACTTCGAAGTCCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129314    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-1359s1c1
Sequence:CCGGCTGACCTTGCTGGTGATCTATCTCGAGATAGATCACCAGCAAGGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128031    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-705s1c1
Sequence:CCGGGATCTTGACCTCTTCTTGGATCTCGAGATCCAAGAAGAGGTCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022830.1-2040s1c1
Sequence:CCGGCTCAAAGTAGATGGACAGAAACTCGAGTTTCTGTCCATCTACTTTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_022830.1-1958s1c1
Sequence:CCGGCCATATAGAACAGGCAACCAACTCGAGTTGGTTGCCTGTTCTATATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_197993
VALIDATED
TUT1 MISSION shRNA Bacterial Glycerol Stock
terminal uridylyl transferase 1, U6 snRNA-specific
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000178546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.1-1996s1c1
Sequence:CCGGGATGTGTTAAGGGAAGCACTACTCGAGTAGTGCTTCCCTTAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.1-2452s1c1
Sequence:CCGGCAGCAACAAACCAAGGAAGAACTCGAGTTCTTCCTTGGTTTGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-2496s21c1
Sequence:CCGGTCGTGTGACCCAGGAACTAAACTCGAGTTTAGTTCCTGGGTCACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1602s21c1
Sequence:CCGGCGTATCTTGCTTGGATCTTTCCTCGAGGAAAGATCCAAGCAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1120s21c1
Sequence:CCGGTTAGAGCTGGTGGGATCTATTCTCGAGAATAGATCCCACCAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1391s21c1
Sequence:CCGGACTACGCCTTGACGTTGTTAGCTCGAGCTAACAACGTCAAGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.2-747s1c1
Sequence:CCGGCTTCTTGGACATGGGTGATATCTCGAGATATCACCCATGTCCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000241191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197993.2-1253s21c1
Sequence:CCGGGTAACCGGTTGGCCTTATATACTCGAGTATATAAGGCCAACCGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_197993
VALIDATED
TUT1 MISSION shRNA shRNA Plasmid DNA
terminal uridylyl transferase 1, U6 snRNA-specific
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000178546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.1-1996s1c1
Sequence:CCGGGATGTGTTAAGGGAAGCACTACTCGAGTAGTGCTTCCCTTAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.1-2452s1c1
Sequence:CCGGCAGCAACAAACCAAGGAAGAACTCGAGTTCTTCCTTGGTTTGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-2496s21c1
Sequence:CCGGTCGTGTGACCCAGGAACTAAACTCGAGTTTAGTTCCTGGGTCACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1602s21c1
Sequence:CCGGCGTATCTTGCTTGGATCTTTCCTCGAGGAAAGATCCAAGCAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1120s21c1
Sequence:CCGGTTAGAGCTGGTGGGATCTATTCTCGAGAATAGATCCCACCAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1391s21c1
Sequence:CCGGACTACGCCTTGACGTTGTTAGCTCGAGCTAACAACGTCAAGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.2-747s1c1
Sequence:CCGGCTTCTTGGACATGGGTGATATCTCGAGATATCACCCATGTCCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000241191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197993.2-1253s21c1
Sequence:CCGGGTAACCGGTTGGCCTTATATACTCGAGTATATAAGGCCAACCGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_197993
VALIDATED
TUT1 MISSION shRNA Lentiviral Transduction Particles
terminal uridylyl transferase 1, U6 snRNA-specific
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000178546    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.1-1996s1c1
Sequence:CCGGGATGTGTTAAGGGAAGCACTACTCGAGTAGTGCTTCCCTTAACACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177876    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.1-2452s1c1
Sequence:CCGGCAGCAACAAACCAAGGAAGAACTCGAGTTCTTCCTTGGTTTGTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241194    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-2496s21c1
Sequence:CCGGTCGTGTGACCCAGGAACTAAACTCGAGTTTAGTTCCTGGGTCACACGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1602s21c1
Sequence:CCGGCGTATCTTGCTTGGATCTTTCCTCGAGGAAAGATCCAAGCAAGATACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1120s21c1
Sequence:CCGGTTAGAGCTGGTGGGATCTATTCTCGAGAATAGATCCCACCAGCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241193    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_197993.2-1391s21c1
Sequence:CCGGACTACGCCTTGACGTTGTTAGCTCGAGCTAACAACGTCAAGGCGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217550    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_197993.2-747s1c1
Sequence:CCGGCTTCTTGGACATGGGTGATATCTCGAGATATCACCCATGTCCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000241191    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_197993.2-1253s21c1
Sequence:CCGGGTAACCGGTTGGCCTTATATACTCGAGTATATAAGGCCAACCGGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks