EMAIL THIS PAGE TO A FRIEND

TVP23A

trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)

Synonyms: FAM18A YDR084C
UniProtKB ID: A6NH52, B2RUV4
Gene ID:
Mouse(383103) trans-golgi network vesicle protein 23A
Rat(360467) trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
dog(490009) trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
domestic guinea pig(100726060) trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
naked mole-rat(101719817) trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
cow(100139027) trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
41 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001079512 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001079512 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001079512 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001013778 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001013778 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001013778 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU025081 MISSION® esiRNA esiRNA human FAM18A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079512 Rosetta Predictions human pricing
NM_001108263 Rosetta Predictions rat pricing
NM_001013778 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079512 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313370 predicted 423
2 SASI_Hs02_00313371 predicted 328
3 SASI_Hs02_00313372 predicted 296
4 SASI_Hs02_00313373 predicted 523
5 SASI_Hs02_00313374 predicted 754
6 SASI_Hs02_00313375 predicted 750
7 SASI_Hs02_00313376 predicted 1205
8 SASI_Hs02_00313377 predicted 897
9 SASI_Hs02_00313378 predicted 987
10 SASI_Hs02_00313379 predicted 1095
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108263 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236934 predicted 892
2 SASI_Rn02_00236935 predicted 649
3 SASI_Rn02_00236936 predicted 419
4 SASI_Rn02_00236937 predicted 479
5 SASI_Rn02_00236938 predicted 453
6 SASI_Rn02_00236939 predicted 445
7 SASI_Rn02_00236940 predicted 477
8 SASI_Rn02_00236941 predicted 337
9 SASI_Rn02_00236942 predicted 608
10 SASI_Rn02_00236943 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013778 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00191463 predicted 1160
2 SASI_Mm02_00287331 predicted 713
3 SASI_Mm01_00191464 predicted 1048
4 SASI_Mm01_00191465 predicted 1200
5 SASI_Mm01_00191466 predicted 646
6 SASI_Mm01_00191467 predicted 865
7 SASI_Mm01_00191469 predicted 600
8 SASI_Mm02_00287332 predicted 602
9 SASI_Mm01_00191470 predicted 398
10 SASI_Mm01_00191471 predicted 587
11 SASI_Mm01_00191468 predicted 438
12 SASI_Mm01_00191472 predicted 836
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001079512
TVP23A MISSION shRNA Bacterial Glycerol Stock
trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000284094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-640s21c1
Sequence:CCGGCTTCTGGCTGGGCCTCATAATCTCGAGATTATGAGGCCCAGCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-589s21c1
Sequence:CCGGCAGGAAGGTCTCTCCGAATAGCTCGAGCTATTCGGAGAGACCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-564s21c1
Sequence:CCGGGGAAGAGCCACTGGATCTTTGCTCGAGCAAAGATCCAGTGGCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079512.2-2942s21c1
Sequence:CCGGCCTACCTAGCACTCATCATTTCTCGAGAAATGATGAGTGCTAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000269932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-534s21c1
Sequence:CCGGTTCGATGGTGGAACCAGATAGCTCGAGCTATCTGGTTCCACCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001079512
TVP23A MISSION shRNA shRNA Plasmid DNA
trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000284094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-640s21c1
Sequence:CCGGCTTCTGGCTGGGCCTCATAATCTCGAGATTATGAGGCCCAGCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-589s21c1
Sequence:CCGGCAGGAAGGTCTCTCCGAATAGCTCGAGCTATTCGGAGAGACCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-564s21c1
Sequence:CCGGGGAAGAGCCACTGGATCTTTGCTCGAGCAAAGATCCAGTGGCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079512.2-2942s21c1
Sequence:CCGGCCTACCTAGCACTCATCATTTCTCGAGAAATGATGAGTGCTAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000269932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-534s21c1
Sequence:CCGGTTCGATGGTGGAACCAGATAGCTCGAGCTATCTGGTTCCACCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001079512
TVP23A MISSION shRNA Lentiviral Transduction Particles
trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000284094    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-640s21c1
Sequence:CCGGCTTCTGGCTGGGCCTCATAATCTCGAGATTATGAGGCCCAGCCAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269854    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-589s21c1
Sequence:CCGGCAGGAAGGTCTCTCCGAATAGCTCGAGCTATTCGGAGAGACCTTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269877    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-564s21c1
Sequence:CCGGGGAAGAGCCACTGGATCTTTGCTCGAGCAAAGATCCAGTGGCTCTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269787    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001079512.2-2942s21c1
Sequence:CCGGCCTACCTAGCACTCATCATTTCTCGAGAAATGATGAGTGCTAGGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000269932    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001079512.2-534s21c1
Sequence:CCGGTTCGATGGTGGAACCAGATAGCTCGAGCTATCTGGTTCCACCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001013778
TVP23A MISSION shRNA Bacterial Glycerol Stock
trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000268217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-828s21c1
Sequence:CCGGTACGGCTACATCCTCTGTAAGCTCGAGCTTACAGAGGATGTAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-636s21c1
Sequence:CCGGTGGATATTTGAAGCCAGAAAGCTCGAGCTTTCTGGCTTCAAATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000268245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-595s21c1
Sequence:CCGGTTCGATGGTGGAACCAGATAGCTCGAGCTATCTGGTTCCACCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013778.1-1447s21c1
Sequence:CCGGCAACCCTATCATGTCCATTATCTCGAGATAATGGACATGATAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000283640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-366s21c1
Sequence:CCGGGTGTCCCTGGACTTCGGTAATCTCGAGATTACCGAAGTCCAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001013778
TVP23A MISSION shRNA shRNA Plasmid DNA
trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000268217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-828s21c1
Sequence:CCGGTACGGCTACATCCTCTGTAAGCTCGAGCTTACAGAGGATGTAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-636s21c1
Sequence:CCGGTGGATATTTGAAGCCAGAAAGCTCGAGCTTTCTGGCTTCAAATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000268245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-595s21c1
Sequence:CCGGTTCGATGGTGGAACCAGATAGCTCGAGCTATCTGGTTCCACCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013778.1-1447s21c1
Sequence:CCGGCAACCCTATCATGTCCATTATCTCGAGATAATGGACATGATAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000283640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-366s21c1
Sequence:CCGGGTGTCCCTGGACTTCGGTAATCTCGAGATTACCGAAGTCCAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001013778
TVP23A MISSION shRNA Lentiviral Transduction Particles
trans-golgi network vesicle protein 23 homolog A (S. cerevisiae)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000268217    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-828s21c1
Sequence:CCGGTACGGCTACATCCTCTGTAAGCTCGAGCTTACAGAGGATGTAGCCGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268218    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-636s21c1
Sequence:CCGGTGGATATTTGAAGCCAGAAAGCTCGAGCTTTCTGGCTTCAAATATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000268245    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-595s21c1
Sequence:CCGGTTCGATGGTGGAACCAGATAGCTCGAGCTATCTGGTTCCACCATCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283642    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001013778.1-1447s21c1
Sequence:CCGGCAACCCTATCATGTCCATTATCTCGAGATAATGGACATGATAGGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000283640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001013778.1-366s21c1
Sequence:CCGGGTGTCCCTGGACTTCGGTAATCTCGAGATTACCGAAGTCCAGGGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks