EMAIL THIS PAGE TO A FRIEND

TVP23B

trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)

Synonyms: FAM18B FAM18B1 NPD008 YDR084C
UniProtKB ID: Q9NYZ1, A8K448, Q96HK5, Q9Y3E6
Gene ID:
Mouse(67510) trans-golgi network vesicle protein 23B
Rat(687358) trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
cow(513550) trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
sheep(101105932) golgi apparatus membrane protein TVP23 homolog B
naked mole-rat(101699112) Golgi apparatus membrane protein TVP23 homolog B
Domestic Rabbit(100343243) Golgi apparatus membrane protein TVP23 homolog B
domestic guinea pig(100731447) Golgi apparatus membrane protein TVP23 homolog B
Zebrafish(554134) trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
domestic cat(101090301) Golgi apparatus membrane protein TVP23 homolog B
dog(489517) Golgi apparatus membrane protein TVP23 homolog B
160 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016078 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016078 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016078 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026210 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026210 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026210 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016078 Rosetta Predictions human pricing
NM_001107568 Rosetta Predictions rat pricing
NM_026210 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016078 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00228692 predicted 285
2 SASI_Hs01_00228693 predicted 559
3 SASI_Hs01_00228695 predicted 701
4 SASI_Hs01_00228696 predicted 344
5 SASI_Hs02_00348826 predicted 645
6 SASI_Hs01_00228697 predicted 687
7 SASI_Hs01_00228698 predicted 559
8 SASI_Hs01_00228699 predicted 405
9 SASI_Hs01_00228700 predicted 422
10 SASI_Hs02_00348827 predicted 673
11 SASI_Hs01_00228694 predicted 641
12 SASI_Hs01_00228701 predicted 639
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107568 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230115 predicted 292
2 SASI_Rn02_00230116 predicted 409
3 SASI_Rn02_00230117 predicted 231
4 SASI_Rn02_00230118 predicted 438
5 SASI_Rn02_00230119 predicted 399
6 SASI_Rn02_00230120 predicted 536
7 SASI_Rn02_00230121 predicted 397
8 SASI_Rn02_00230122 predicted 263
9 SASI_Rn02_00230123 predicted 332
10 SASI_Rn02_00230124 predicted 366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026210 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329877 predicted 692
2 SASI_Mm01_00099048 predicted 786
3 SASI_Mm01_00099049 predicted 789
4 SASI_Mm02_00329878 predicted 989
5 SASI_Mm01_00099050 predicted 710
6 SASI_Mm01_00099051 predicted 327
7 SASI_Mm01_00099053 predicted 608
8 SASI_Mm01_00099054 predicted 888
9 SASI_Mm01_00099056 predicted 844
10 SASI_Mm01_00099057 predicted 759
11 SASI_Mm01_00099052 predicted 994
12 SASI_Mm01_00099055 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016078
VALIDATED
TVP23B MISSION shRNA Bacterial Glycerol Stock
trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000426349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016078.4-959s21c1
Sequence:CCGGCATAGGTAATGGAGACCTTTGCTCGAGCAAAGGTCTCCATTACCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016078.4-294s21c1
Sequence:CCGGTACGTTGGTGGAATCACATTGCTCGAGCAATGTGATTCCACCAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016078.4-159s21c1
Sequence:CCGGTCAGTGCAATCATCGTCTATCCTCGAGGATAGACGATGATTGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-630s1c1
Sequence:CCGGGAGTCCTCTCAAGAGAATAAACTCGAGTTTATTCTCTTGAGAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-446s1c1
Sequence:CCGGCGTCTATCTTCTCTGTGAGTTCTCGAGAACTCACAGAGAAGATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016078.1-336s1c1
Sequence:CCGGGTTTCACTGTTTGATGCGGAACTCGAGTTCCGCATCAAACAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016078.1-362s1c1
Sequence:CCGGGACGACTAATAGACCAAGAAACTCGAGTTTCTTGGTCTATTAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016078.1-464s1c1
Sequence:CCGGGTTGCTCAGCAGCAGCTTTATCTCGAGATAAAGCTGCTGCTGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-472s1c1
Sequence:CCGGGCAGCAGCTTTATTACCTGTACTCGAGTACAGGTAATAAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-532s1c1
Sequence:CCGGCAGTGAAGAATGTCACAGGTACTCGAGTACCTGTGACATTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016078
VALIDATED
TVP23B MISSION shRNA shRNA Plasmid DNA
trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000426349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016078.4-959s21c1
Sequence:CCGGCATAGGTAATGGAGACCTTTGCTCGAGCAAAGGTCTCCATTACCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016078.4-294s21c1
Sequence:CCGGTACGTTGGTGGAATCACATTGCTCGAGCAATGTGATTCCACCAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016078.4-159s21c1
Sequence:CCGGTCAGTGCAATCATCGTCTATCCTCGAGGATAGACGATGATTGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-630s1c1
Sequence:CCGGGAGTCCTCTCAAGAGAATAAACTCGAGTTTATTCTCTTGAGAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-446s1c1
Sequence:CCGGCGTCTATCTTCTCTGTGAGTTCTCGAGAACTCACAGAGAAGATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016078.1-336s1c1
Sequence:CCGGGTTTCACTGTTTGATGCGGAACTCGAGTTCCGCATCAAACAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016078.1-362s1c1
Sequence:CCGGGACGACTAATAGACCAAGAAACTCGAGTTTCTTGGTCTATTAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016078.1-464s1c1
Sequence:CCGGGTTGCTCAGCAGCAGCTTTATCTCGAGATAAAGCTGCTGCTGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-472s1c1
Sequence:CCGGGCAGCAGCTTTATTACCTGTACTCGAGTACAGGTAATAAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-532s1c1
Sequence:CCGGCAGTGAAGAATGTCACAGGTACTCGAGTACCTGTGACATTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016078
VALIDATED
TVP23B MISSION shRNA Lentiviral Transduction Particles
trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000426349    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016078.4-959s21c1
Sequence:CCGGCATAGGTAATGGAGACCTTTGCTCGAGCAAAGGTCTCCATTACCTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413596    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016078.4-294s21c1
Sequence:CCGGTACGTTGGTGGAATCACATTGCTCGAGCAATGTGATTCCACCAACGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016078.4-159s21c1
Sequence:CCGGTCAGTGCAATCATCGTCTATCCTCGAGGATAGACGATGATTGCACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-630s1c1
Sequence:CCGGGAGTCCTCTCAAGAGAATAAACTCGAGTTTATTCTCTTGAGAGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148527    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-446s1c1
Sequence:CCGGCGTCTATCTTCTCTGTGAGTTCTCGAGAACTCACAGAGAAGATAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149371    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016078.1-336s1c1
Sequence:CCGGGTTTCACTGTTTGATGCGGAACTCGAGTTCCGCATCAAACAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147919    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016078.1-362s1c1
Sequence:CCGGGACGACTAATAGACCAAGAAACTCGAGTTTCTTGGTCTATTAGTCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131117    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016078.1-464s1c1
Sequence:CCGGGTTGCTCAGCAGCAGCTTTATCTCGAGATAAAGCTGCTGCTGAGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127763    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-472s1c1
Sequence:CCGGGCAGCAGCTTTATTACCTGTACTCGAGTACAGGTAATAAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_016078.1-532s1c1
Sequence:CCGGCAGTGAAGAATGTCACAGGTACTCGAGTACCTGTGACATTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026210
VALIDATED
TVP23B MISSION shRNA Bacterial Glycerol Stock
trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-1295s1c1
Sequence:CCGGGCTGTGTTTCTTTGTGACCATCTCGAGATGGTCACAAAGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-133s1c1
Sequence:CCGGGTCTCACTGTTTGATGCAGAACTCGAGTTCTGCATCAAACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-363s1c1
Sequence:CCGGCCTGCGTTGGTGGAATCATATCTCGAGATATGATTCCACCAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-328s1c1
Sequence:CCGGGCAGTAAAGAATGTCACAGGTCTCGAGACCTGTGACATTCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026210
VALIDATED
TVP23B MISSION shRNA shRNA Plasmid DNA
trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-1295s1c1
Sequence:CCGGGCTGTGTTTCTTTGTGACCATCTCGAGATGGTCACAAAGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-133s1c1
Sequence:CCGGGTCTCACTGTTTGATGCAGAACTCGAGTTCTGCATCAAACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-363s1c1
Sequence:CCGGCCTGCGTTGGTGGAATCATATCTCGAGATATGATTCCACCAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-328s1c1
Sequence:CCGGGCAGTAAAGAATGTCACAGGTCTCGAGACCTGTGACATTCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026210
VALIDATED
TVP23B MISSION shRNA Lentiviral Transduction Particles
trans-golgi network vesicle protein 23 homolog B (S. cerevisiae)
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176231    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-1295s1c1
Sequence:CCGGGCTGTGTTTCTTTGTGACCATCTCGAGATGGTCACAAAGAAACACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-133s1c1
Sequence:CCGGGTCTCACTGTTTGATGCAGAACTCGAGTTCTGCATCAAACAGTGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194574    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-363s1c1
Sequence:CCGGCCTGCGTTGGTGGAATCATATCTCGAGATATGATTCCACCAACGCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193978    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026210.2-328s1c1
Sequence:CCGGGCAGTAAAGAATGTCACAGGTCTCGAGACCTGTGACATTCTTTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks