EMAIL THIS PAGE TO A FRIEND

TVP23C

trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)

Synonyms: FAM18B2
Species: Human TVP23C(201158)
UniProtKB ID: Q96ET8, Q3LIC7
Gene ID:
15 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA065603 Anti-TVP23C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_145301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_145301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_145301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_145301 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215807 predicted 192
2 SASI_Hs02_00365194 predicted 290
3 SASI_Hs01_00215808 predicted 259
4 SASI_Hs01_00215809 predicted 262
5 SASI_Hs01_00215810 predicted 271
6 SASI_Hs01_00215811 predicted 249
7 SASI_Hs01_00215812 predicted 261
8 SASI_Hs01_00215813 predicted 217
9 SASI_Hs01_00215814 predicted 208
10 SASI_Hs01_00215815 predicted 196
11 SASI_Hs01_00215816 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145301
VALIDATED
TVP23C MISSION shRNA Bacterial Glycerol Stock
trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000138947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145301.1-1050s1c1
Sequence:CCGGGAGAGAGAGGAGAGAGAGAAACTCGAGTTTCTCTCTCTCCTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145301.1-1061s1c1
Sequence:CCGGGAGAGAGAAAGAACGAACGAACTCGAGTTCGTTCGTTCTTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145301.1-256s1c1
Sequence:CCGGGCAGCAGCTTTATTACCTGTACTCGAGTACAGGTAATAAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145301.1-323s1c1
Sequence:CCGGGAATGTCACAGGTAGACTAATCTCGAGATTAGTCTACCTGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-316s1c1
Sequence:CCGGCAGTGAAGAATGTCACAGGTACTCGAGTACCTGTGACATTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-315s1c1
Sequence:CCGGGCAGTGAAGAATGTCACAGGTCTCGAGACCTGTGACATTCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145301.1-714s1c1
Sequence:CCGGCGAGCTCTTTACTGGAAACCTCTCGAGAGGTTTCCAGTAAAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145301.1-1074s1c1
Sequence:CCGGCGAACGAACAGGGAACTTGTACTCGAGTACAAGTTCCCTGTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-516s1c1
Sequence:CCGGGCACTCTTCTCCTTCACAGTACTCGAGTACTGTGAAGGAGAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145301.1-804s1c1
Sequence:CCGGCTATTTCTCTCCTTGCGGCTTCTCGAGAAGCCGCAAGGAGAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145301.1-1375s1c1
Sequence:CCGGCAGAATGACAGGCCCTTACTTCTCGAGAAGTAAGGGCCTGTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145301
VALIDATED
TVP23C MISSION shRNA shRNA Plasmid DNA
trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000138947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145301.1-1050s1c1
Sequence:CCGGGAGAGAGAGGAGAGAGAGAAACTCGAGTTTCTCTCTCTCCTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145301.1-1061s1c1
Sequence:CCGGGAGAGAGAAAGAACGAACGAACTCGAGTTCGTTCGTTCTTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145301.1-256s1c1
Sequence:CCGGGCAGCAGCTTTATTACCTGTACTCGAGTACAGGTAATAAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145301.1-323s1c1
Sequence:CCGGGAATGTCACAGGTAGACTAATCTCGAGATTAGTCTACCTGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-316s1c1
Sequence:CCGGCAGTGAAGAATGTCACAGGTACTCGAGTACCTGTGACATTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-315s1c1
Sequence:CCGGGCAGTGAAGAATGTCACAGGTCTCGAGACCTGTGACATTCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145301.1-714s1c1
Sequence:CCGGCGAGCTCTTTACTGGAAACCTCTCGAGAGGTTTCCAGTAAAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145301.1-1074s1c1
Sequence:CCGGCGAACGAACAGGGAACTTGTACTCGAGTACAAGTTCCCTGTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-516s1c1
Sequence:CCGGGCACTCTTCTCCTTCACAGTACTCGAGTACTGTGAAGGAGAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145301.1-804s1c1
Sequence:CCGGCTATTTCTCTCCTTGCGGCTTCTCGAGAAGCCGCAAGGAGAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145301.1-1375s1c1
Sequence:CCGGCAGAATGACAGGCCCTTACTTCTCGAGAAGTAAGGGCCTGTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145301
VALIDATED
TVP23C MISSION shRNA Lentiviral Transduction Particles
trans-golgi network vesicle protein 23 homolog C (S. cerevisiae)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000138947    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145301.1-1050s1c1
Sequence:CCGGGAGAGAGAGGAGAGAGAGAAACTCGAGTTTCTCTCTCTCCTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137250    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_145301.1-1061s1c1
Sequence:CCGGGAGAGAGAAAGAACGAACGAACTCGAGTTCGTTCGTTCTTTCTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_145301.1-256s1c1
Sequence:CCGGGCAGCAGCTTTATTACCTGTACTCGAGTACAGGTAATAAAGCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134426    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: MCH58
TRC Version: 1.5 Clone ID:NM_145301.1-323s1c1
Sequence:CCGGGAATGTCACAGGTAGACTAATCTCGAGATTAGTCTACCTGTGACATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136799    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-316s1c1
Sequence:CCGGCAGTGAAGAATGTCACAGGTACTCGAGTACCTGTGACATTCTTCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137769    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-315s1c1
Sequence:CCGGGCAGTGAAGAATGTCACAGGTCTCGAGACCTGTGACATTCTTCACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138447    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145301.1-714s1c1
Sequence:CCGGCGAGCTCTTTACTGGAAACCTCTCGAGAGGTTTCCAGTAAAGAGCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138421    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145301.1-1074s1c1
Sequence:CCGGCGAACGAACAGGGAACTTGTACTCGAGTACAAGTTCCCTGTTCGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138106    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_145301.1-516s1c1
Sequence:CCGGGCACTCTTCTCCTTCACAGTACTCGAGTACTGTGAAGGAGAAGAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145301.1-804s1c1
Sequence:CCGGCTATTTCTCTCCTTGCGGCTTCTCGAGAAGCCGCAAGGAGAGAAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138510    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145301.1-1375s1c1
Sequence:CCGGCAGAATGACAGGCCCTTACTTCTCGAGAAGTAAGGGCCTGTCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks