EMAIL THIS PAGE TO A FRIEND

TWF1

twinfilin actin-binding protein 1

Synonyms: A6 PTK9
Gene ID:
Human(5756) Summary: This gene encodes twinfilin, an actin monomer-binding protein conserved from yeast to mammals. Studies of the mouse counterpart suggest that this protein may be an actin monomer-binding protein, and its localization to cortical G-actin-rich structures may be regulated by the small GTPase RAC1. [provided by RefSeq, Jul 2008]
Mouse(19230) twinfilin, actin-binding protein, homolog 1 (Drosophila)
Rat(315265) twinfilin actin-binding protein 1
chicken(417797) twinfilin, actin-binding protein, homolog 1 (Drosophila)
domestic cat(101081311) twinfilin, actin-binding protein, homolog 1 (Drosophila)
Horse(100054895) twinfilin, actin-binding protein, homolog 1 (Drosophila)
dog(486600) twinfilin, actin-binding protein, homolog 1 (Drosophila)
domestic guinea pig(100729479) twinfilin actin-binding protein 1
naked mole-rat(101697215) twinfilin actin-binding protein 1
cow(506683) twinfilin, actin-binding protein, homolog 1 (Drosophila)
sheep(101114765) twinfilin, actin-binding protein, homolog 1 (Drosophila)
Gene Class: Cytoskeleton
186 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1412062 ANTI-PTK9 antibody produced in mouse clone 2B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1406341 Anti-TWF1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA018116 Anti-TWF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human, mouse, rat
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107188 Anti-TWF1 antibody produced in rabbit affinity isolated antibody human, guinea pig, rabbit, rat, horse
ELISA, western blot pricing
SAB1411149 Anti-TWF1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB2104684 Anti-TWF1, (N-terminal) antibody produced in rabbit affinity isolated antibody pig, rat, bovine, zebrafish, mouse, human
western blot pricing
WH0005756M1 Monoclonal Anti-PTK9 antibody produced in mouse clone 5E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409575 Monoclonal Anti-PTK9 antibody produced in mouse clone 5C4, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, western blot pricing
SAB1409576 Monoclonal Anti-PTK9 antibody produced in mouse clone 1D12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1404277 Monoclonal Anti-PTK9, (C-terminal) antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution rat, human
ELISA, immunohistochemistry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T5568 Tyrphostin AG 835 ≥92% human pricing
T5318 Tyrphostin AG 808 ≥98% human, mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002822 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002822 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002822 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008971 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008971 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008971 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002822 siRNAs that have been validated in the lab human pricing
NM_198974 siRNAs that have been validated in the lab human pricing
NM_001008521 Rosetta Predictions rat pricing
NM_008971 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002822 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215768 validated 870
1 SASI_Hs01_00215770 validated 805
1 SASI_Hs01_00215767 validated 1176
2 SASI_Hs01_00215769 predicted 866
3 SASI_Hs02_00334522 predicted 320
4 SASI_Hs01_00215771 predicted 1127
5 SASI_Hs01_00215772 predicted 902
6 SASI_Hs01_00215773 predicted 478
7 SASI_Hs01_00215774 predicted 717
8 SASI_Hs02_00334523 predicted 361
9 SASI_Hs01_00215775 predicted 1172
10 SASI_Hs01_00215776 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198974 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237649 validated 1563
2 SASI_Hs01_00237650 predicted 1262
3 SASI_Hs01_00237651 predicted 1260
4 SASI_Hs01_00237652 predicted 1201
5 SASI_Hs01_00237653 predicted 1518
6 SASI_Hs01_00237654 predicted 1303
7 SASI_Hs01_00237655 predicted 877
8 SASI_Hs01_00237656 predicted 1109
9 SASI_Hs01_00237657 predicted 1564
10 SASI_Hs01_00237658 predicted 1054
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008521 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087753 predicted 487
2 SASI_Rn02_00199203 predicted 839
3 SASI_Rn01_00087754 predicted 342
4 SASI_Rn01_00087755 predicted 515
5 SASI_Rn01_00087756 predicted 743
6 SASI_Rn01_00087757 predicted 581
7 SASI_Rn01_00087759 predicted 391
8 SASI_Rn01_00087760 predicted 238
9 SASI_Rn01_00087761 predicted 531
10 SASI_Rn02_00199204 predicted 593
11 SASI_Rn01_00087752 predicted 1128
12 SASI_Rn01_00087758 predicted 389
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008971 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190913 predicted 352
2 SASI_Mm01_00190915 predicted 1090
3 SASI_Mm01_00190912 predicted 426
4 SASI_Mm01_00190914 predicted 391
5 SASI_Mm01_00190916 predicted 275
6 SASI_Mm01_00190917 predicted 609
7 SASI_Mm01_00190918 predicted 289
8 SASI_Mm01_00190919 predicted 637
9 SASI_Mm01_00190920 predicted 1170
10 SASI_Mm01_00190921 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002822
VALIDATED
TWF1 MISSION shRNA Bacterial Glycerol Stock
twinfilin actin-binding protein 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000006364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-2014s1c1
Sequence:CCGGCCGAGCAAATACTCAGATTTACTCGAGTAAATCTGAGTATTTGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-364s1c1
Sequence:CCGGCCAGGGATATGAATGGATATTCTCGAGAATATCCATTCATATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002822.3-962s1c1
Sequence:CCGGCGTCTGCTAGAAATTGTAGAACTCGAGTTCTACAATTTCTAGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000006366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-474s1c1
Sequence:CCGGGCCACATTAAAGATGAAGTATCTCGAGATACTTCATCTTTAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002822.3-2692s1c1
Sequence:CCGGCTACCTGTCATGAAGGTATAACTCGAGTTATACCTTCATGACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002822.3-236s1c1
Sequence:CCGGCAACTTGTGATTGGATCATATCTCGAGATATGATCCAATCACAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002822.3-238s21c1
Sequence:GTACCGGACTTGTGATTGGATCATATAGCTCGAGCTATATGATCCAATCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-364s21c1
Sequence:CCGGCCAGGGATATGAATGGATATTCTCGAGAATATCCATTCATATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-474s21c1
Sequence:CCGGGCCACATTAAAGATGAAGTATCTCGAGATACTTCATCTTTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002822.3-860s21c1
Sequence:CCGGTCCCATGAAGGAGACTATTTACTCGAGTAAATAGTCTCCTTCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-2014s21c1
Sequence:CCGGCCGAGCAAATACTCAGATTTACTCGAGTAAATCTGAGTATTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002822
VALIDATED
TWF1 MISSION shRNA shRNA Plasmid DNA
twinfilin actin-binding protein 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000006364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-2014s1c1
Sequence:CCGGCCGAGCAAATACTCAGATTTACTCGAGTAAATCTGAGTATTTGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-364s1c1
Sequence:CCGGCCAGGGATATGAATGGATATTCTCGAGAATATCCATTCATATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002822.3-962s1c1
Sequence:CCGGCGTCTGCTAGAAATTGTAGAACTCGAGTTCTACAATTTCTAGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000006366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-474s1c1
Sequence:CCGGGCCACATTAAAGATGAAGTATCTCGAGATACTTCATCTTTAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002822.3-2692s1c1
Sequence:CCGGCTACCTGTCATGAAGGTATAACTCGAGTTATACCTTCATGACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002822.3-236s1c1
Sequence:CCGGCAACTTGTGATTGGATCATATCTCGAGATATGATCCAATCACAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002822.3-238s21c1
Sequence:GTACCGGACTTGTGATTGGATCATATAGCTCGAGCTATATGATCCAATCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-364s21c1
Sequence:CCGGCCAGGGATATGAATGGATATTCTCGAGAATATCCATTCATATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-474s21c1
Sequence:CCGGGCCACATTAAAGATGAAGTATCTCGAGATACTTCATCTTTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002822.3-860s21c1
Sequence:CCGGTCCCATGAAGGAGACTATTTACTCGAGTAAATAGTCTCCTTCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-2014s21c1
Sequence:CCGGCCGAGCAAATACTCAGATTTACTCGAGTAAATCTGAGTATTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002822
VALIDATED
TWF1 MISSION shRNA Lentiviral Transduction Particles
twinfilin actin-binding protein 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000006364    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-2014s1c1
Sequence:CCGGCCGAGCAAATACTCAGATTTACTCGAGTAAATCTGAGTATTTGCTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006365    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-364s1c1
Sequence:CCGGCCAGGGATATGAATGGATATTCTCGAGAATATCCATTCATATCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006367    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A3
TRC Version: 1 Clone ID:NM_002822.3-962s1c1
Sequence:CCGGCGTCTGCTAGAAATTGTAGAACTCGAGTTCTACAATTTCTAGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000006366    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_002822.3-474s1c1
Sequence:CCGGGCCACATTAAAGATGAAGTATCTCGAGATACTTCATCTTTAATGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195006    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_002822.3-2692s1c1
Sequence:CCGGCTACCTGTCATGAAGGTATAACTCGAGTTATACCTTCATGACAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194765    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_002822.3-236s1c1
Sequence:CCGGCAACTTGTGATTGGATCATATCTCGAGATATGATCCAATCACAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380535    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002822.3-238s21c1
Sequence:GTACCGGACTTGTGATTGGATCATATAGCTCGAGCTATATGATCCAATCACAAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338481    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-364s21c1
Sequence:CCGGCCAGGGATATGAATGGATATTCTCGAGAATATCCATTCATATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-474s21c1
Sequence:CCGGGCCACATTAAAGATGAAGTATCTCGAGATACTTCATCTTTAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002822.3-860s21c1
Sequence:CCGGTCCCATGAAGGAGACTATTTACTCGAGTAAATAGTCTCCTTCATGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338483    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_002822.3-2014s21c1
Sequence:CCGGCCGAGCAAATACTCAGATTTACTCGAGTAAATCTGAGTATTTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008971
VALIDATED
TWF1 MISSION shRNA Bacterial Glycerol Stock
twinfilin actin-binding protein 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000023825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-298s1c1
Sequence:CCGGCCCAGGGATATGAATGGATATCTCGAGATATCCATTCATATCCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-641s1c1
Sequence:CCGGGCTGAGTAAGAAGCAGCTCAACTCGAGTTGAGCTGCTTCTTACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-767s1c1
Sequence:CCGGGCGTTACCATTTCTTTCTGTACTCGAGTACAGAAAGAAATGGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-131s1c1
Sequence:CCGGCGGGAAATACAGACTTCTGAACTCGAGTTCAGAAGTCTGTATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-381s1c1
Sequence:CCGGGCGACTCTGAAGAAAGAATTTCTCGAGAAATTCTTTCTTCAGAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-750s21c1
Sequence:CCGGGCGTTACCATTTCTTTCTGTACTCGAGTACAGAAAGAAATGGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-624s21c1
Sequence:CCGGGCTGAGTAAGAAGCAGCTCAACTCGAGTTGAGCTGCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-364s21c1
Sequence:CCGGGCGACTCTGAAGAAAGAATTTCTCGAGAAATTCTTTCTTCAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-114s21c1
Sequence:CCGGCGGGAAATACAGACTTCTGAACTCGAGTTCAGAAGTCTGTATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008971
VALIDATED
TWF1 MISSION shRNA shRNA Plasmid DNA
twinfilin actin-binding protein 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000023825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-298s1c1
Sequence:CCGGCCCAGGGATATGAATGGATATCTCGAGATATCCATTCATATCCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-641s1c1
Sequence:CCGGGCTGAGTAAGAAGCAGCTCAACTCGAGTTGAGCTGCTTCTTACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-767s1c1
Sequence:CCGGGCGTTACCATTTCTTTCTGTACTCGAGTACAGAAAGAAATGGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-131s1c1
Sequence:CCGGCGGGAAATACAGACTTCTGAACTCGAGTTCAGAAGTCTGTATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-381s1c1
Sequence:CCGGGCGACTCTGAAGAAAGAATTTCTCGAGAAATTCTTTCTTCAGAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-750s21c1
Sequence:CCGGGCGTTACCATTTCTTTCTGTACTCGAGTACAGAAAGAAATGGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-624s21c1
Sequence:CCGGGCTGAGTAAGAAGCAGCTCAACTCGAGTTGAGCTGCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-364s21c1
Sequence:CCGGGCGACTCTGAAGAAAGAATTTCTCGAGAAATTCTTTCTTCAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-114s21c1
Sequence:CCGGCGGGAAATACAGACTTCTGAACTCGAGTTCAGAAGTCTGTATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008971
VALIDATED
TWF1 MISSION shRNA Lentiviral Transduction Particles
twinfilin actin-binding protein 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000023825    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-298s1c1
Sequence:CCGGCCCAGGGATATGAATGGATATCTCGAGATATCCATTCATATCCCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023826    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-641s1c1
Sequence:CCGGGCTGAGTAAGAAGCAGCTCAACTCGAGTTGAGCTGCTTCTTACTCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023827    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-767s1c1
Sequence:CCGGGCGTTACCATTTCTTTCTGTACTCGAGTACAGAAAGAAATGGTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-131s1c1
Sequence:CCGGCGGGAAATACAGACTTCTGAACTCGAGTTCAGAAGTCTGTATTTCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023828    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_008971.2-381s1c1
Sequence:CCGGGCGACTCTGAAGAAAGAATTTCTCGAGAAATTCTTTCTTCAGAGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-750s21c1
Sequence:CCGGGCGTTACCATTTCTTTCTGTACTCGAGTACAGAAAGAAATGGTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-624s21c1
Sequence:CCGGGCTGAGTAAGAAGCAGCTCAACTCGAGTTGAGCTGCTTCTTACTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345182    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-364s21c1
Sequence:CCGGGCGACTCTGAAGAAAGAATTTCTCGAGAAATTCTTTCTTCAGAGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345181    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008971.4-114s21c1
Sequence:CCGGCGGGAAATACAGACTTCTGAACTCGAGTTCAGAAGTCTGTATTTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks