EMAIL THIS PAGE TO A FRIEND

TWF2

twinfilin actin-binding protein 2

Synonyms: A6RP A6r PTK9L
UniProtKB ID: Q6IBS0, Q9Y3F5
Gene ID:
Human(11344) Summary: The protein encoded by this gene was identified by its interaction with the catalytic domain of protein kinase C-zeta. The encoded protein contains an actin-binding site and an ATP-binding site. It is most closely related to twinfilin (PTK9), a conserved actin monomer-binding protein. [provided by RefSeq, Jul 2008]
Mouse(23999) twinfilin, actin-binding protein, homolog 2 (Drosophila)
Rat(684352) twinfilin actin-binding protein 2
Zebrafish(100310784) twinfilin-like protein
Horse(100629175) twinfilin, actin-binding protein, homolog 2 (Drosophila)
domestic cat(101081125) twinfilin, actin-binding protein, homolog 2 (Drosophila)
dog(100684904) twinfilin, actin-binding protein, homolog 2 (Drosophila)
chicken(415940) twinfilin, actin-binding protein, homolog 2 (Drosophila)
cow(282024) twinfilin, actin-binding protein, homolog 2 (Drosophila)
sheep(101112603) twinfilin, actin-binding protein, homolog 2 (Drosophila)
naked mole-rat(101703392) twinfilin actin-binding protein 2
domestic guinea pig(100724130) twinfilin actin-binding protein 2
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007284 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007284 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007284 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011876 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011876 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011876 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU024171 MISSION® esiRNA esiRNA targeting mouse Twf2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007284 Rosetta Predictions human pricing
XM_001070490 Rosetta Predictions rat pricing
XM_001070530 Rosetta Predictions rat pricing
NM_011876 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007284 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00026415 predicted 938
2 SASI_Hs02_00343350 predicted 901
3 SASI_Hs01_00026419 predicted 1161
4 SASI_Hs01_00026420 predicted 1063
5 SASI_Hs02_00343351 predicted 1265
6 SASI_Hs01_00026423 predicted 939
7 SASI_Hs02_00343352 predicted 1390
8 SASI_Hs02_00343353 predicted 230
9 SASI_Hs02_00343354 predicted 1242
10 SASI_Hs02_00343355 predicted 1368
11 SASI_Hs01_00026414 predicted 954
12 SASI_Hs01_00026416 predicted 226
13 SASI_Hs01_00026417 predicted 279
14 SASI_Hs01_00026418 predicted 218
15 SASI_Hs01_00026421 predicted 227
16 SASI_Hs01_00026422 predicted 1292
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070490 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331858 predicted 799
2 SASI_Rn02_00331859 predicted 805
3 SASI_Rn02_00331860 predicted 765
4 SASI_Rn02_00331861 predicted 253
5 SASI_Rn02_00331862 predicted 772
6 SASI_Rn02_00331863 predicted 849
7 SASI_Rn02_00331864 predicted 748
8 SASI_Rn02_00331865 predicted 637
9 SASI_Rn02_00331866 predicted 374
10 SASI_Rn02_00331867 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00331975 predicted 1325
2 SASI_Rn02_00331976 predicted 886
3 SASI_Rn02_00331977 predicted 905
4 SASI_Rn02_00331978 predicted 851
5 SASI_Rn02_00331979 predicted 345
6 SASI_Rn02_00331980 predicted 862
7 SASI_Rn02_00331981 predicted 947
8 SASI_Rn02_00331982 predicted 844
9 SASI_Rn02_00331983 predicted 733
10 SASI_Rn02_00331984 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011876 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00321666 predicted 220
2 SASI_Mm01_00074271 predicted 889
3 SASI_Mm01_00074272 predicted 931
4 SASI_Mm01_00074273 predicted 445
5 SASI_Mm01_00074274 predicted 738
6 SASI_Mm01_00074276 predicted 1284
7 SASI_Mm01_00074277 predicted 1190
8 SASI_Mm01_00074278 predicted 868
9 SASI_Mm01_00074279 predicted 1056
10 SASI_Mm02_00321667 predicted 1360
11 SASI_Mm01_00074270 predicted 903
12 SASI_Mm01_00074275 predicted 355
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007284
VALIDATED
TWF2 MISSION shRNA Bacterial Glycerol Stock
twinfilin actin-binding protein 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000381657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1383s21c1
Sequence:GTACCGGTGTCCCTGCATCTCGTCTGTGCTCGAGCACAGACGAGATGCAGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-187s21c1
Sequence:CCGGGCTGAAGGAATTCTTTGCCAACTCGAGTTGGCAAAGAATTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-897s21c1
Sequence:CCGGCCCTTGAGTCTGTAGTGTTCACTCGAGTGAACACTACAGACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-610s21c1
Sequence:CCGGGCTCCAGCAGATCCGCATTAACTCGAGTTAATGCGGATCTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-522s21c1
Sequence:CCGGCTGTGAAGGATGACCTCTCTTCTCGAGAAGAGAGGTCATCCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1290s21c1
Sequence:GTACCGGAGTGTTTCTGGGAGGTCAGGACTCGAGTCCTGACCTCCCAGAAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000379611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1362s21c1
Sequence:GTACCGGTTTGTGACCCTTCCCTGTTGCCTCGAGGCAACAGGGAAGGGTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007284.3-1064s1c1
Sequence:CCGGGCAGAGTTCCTCTACGACGAGCTCGAGCTCGTCGTAGAGGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007284.3-897s1c1
Sequence:CCGGCCCTTGAGTCTGTAGTGTTCACTCGAGTGAACACTACAGACTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000021421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007284.3-522s1c1
Sequence:CCGGCTGTGAAGGATGACCTCTCTTCTCGAGAAGAGAGGTCATCCTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007284
VALIDATED
TWF2 MISSION shRNA shRNA Plasmid DNA
twinfilin actin-binding protein 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000381657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1383s21c1
Sequence:GTACCGGTGTCCCTGCATCTCGTCTGTGCTCGAGCACAGACGAGATGCAGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-187s21c1
Sequence:CCGGGCTGAAGGAATTCTTTGCCAACTCGAGTTGGCAAAGAATTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-897s21c1
Sequence:CCGGCCCTTGAGTCTGTAGTGTTCACTCGAGTGAACACTACAGACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-610s21c1
Sequence:CCGGGCTCCAGCAGATCCGCATTAACTCGAGTTAATGCGGATCTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-522s21c1
Sequence:CCGGCTGTGAAGGATGACCTCTCTTCTCGAGAAGAGAGGTCATCCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1290s21c1
Sequence:GTACCGGAGTGTTTCTGGGAGGTCAGGACTCGAGTCCTGACCTCCCAGAAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000379611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1362s21c1
Sequence:GTACCGGTTTGTGACCCTTCCCTGTTGCCTCGAGGCAACAGGGAAGGGTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007284.3-1064s1c1
Sequence:CCGGGCAGAGTTCCTCTACGACGAGCTCGAGCTCGTCGTAGAGGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007284.3-897s1c1
Sequence:CCGGCCCTTGAGTCTGTAGTGTTCACTCGAGTGAACACTACAGACTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000021421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007284.3-522s1c1
Sequence:CCGGCTGTGAAGGATGACCTCTCTTCTCGAGAAGAGAGGTCATCCTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007284
VALIDATED
TWF2 MISSION shRNA Lentiviral Transduction Particles
twinfilin actin-binding protein 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000381657    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1383s21c1
Sequence:GTACCGGTGTCCCTGCATCTCGTCTGTGCTCGAGCACAGACGAGATGCAGGGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297806    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-187s21c1
Sequence:CCGGGCTGAAGGAATTCTTTGCCAACTCGAGTTGGCAAAGAATTCCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280266    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-897s21c1
Sequence:CCGGCCCTTGAGTCTGTAGTGTTCACTCGAGTGAACACTACAGACTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-610s21c1
Sequence:CCGGGCTCCAGCAGATCCGCATTAACTCGAGTTAATGCGGATCTGCTGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_007284.3-522s21c1
Sequence:CCGGCTGTGAAGGATGACCTCTCTTCTCGAGAAGAGAGGTCATCCTTCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379978    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1290s21c1
Sequence:GTACCGGAGTGTTTCTGGGAGGTCAGGACTCGAGTCCTGACCTCCCAGAAACACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000379611    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007284.3-1362s21c1
Sequence:GTACCGGTTTGTGACCCTTCCCTGTTGCCTCGAGGCAACAGGGAAGGGTCACAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199473    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007284.3-1064s1c1
Sequence:CCGGGCAGAGTTCCTCTACGACGAGCTCGAGCTCGTCGTAGAGGAACTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021422    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_007284.3-897s1c1
Sequence:CCGGCCCTTGAGTCTGTAGTGTTCACTCGAGTGAACACTACAGACTCAAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000021421    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_007284.3-522s1c1
Sequence:CCGGCTGTGAAGGATGACCTCTCTTCTCGAGAAGAGAGGTCATCCTTCACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011876
VALIDATED
TWF2 MISSION shRNA Bacterial Glycerol Stock
twinfilin actin-binding protein 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000363391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011876.3-1281s21c1
Sequence:CCGGAGCCTGGGCTCTAAGGAATTGCTCGAGCAATTCCTTAGAGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-1016s21c1
Sequence:CCGGGCTGGAGATAGCTAAGAAGATCTCGAGATCTTCTTAGCTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011876.3-436s21c1
Sequence:CCGGTGCGGCTGAAGATGCTATATGCTCGAGCATATAGCATCTTCAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000322122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-364s21c1
Sequence:CCGGTCCGACTTGATTCGCAGAATGCTCGAGCATTCTGCGAATCAAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011876.3-620s21c1
Sequence:CCGGGATCCGAATCAATGAGGTGAACTCGAGTTCACCTCATTGATTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-734s21c1
Sequence:CCGGACAGAAGACGGTCAACTATATCTCGAGATATAGTTGACCGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011876.3-1324s21c1
Sequence:CCGGCAGGTGGCTGACCATATCTGACTCGAGTCAGATATGGTCAGCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-228s1c1
Sequence:CCGGCGACTTATCAAAGTCATCATTCTCGAGAATGATGACTTTGATAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-899s1c1
Sequence:CCGGCCTTGAATCTGTGGTGTTCATCTCGAGATGAACACCACAGATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-1016s1c1
Sequence:CCGGGCTGGAGATAGCTAAGAAGATCTCGAGATCTTCTTAGCTATCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-620s1c1
Sequence:CCGGGATCCGAATCAATGAGGTGAACTCGAGTTCACCTCATTGATTCGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011876
VALIDATED
TWF2 MISSION shRNA shRNA Plasmid DNA
twinfilin actin-binding protein 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000363391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011876.3-1281s21c1
Sequence:CCGGAGCCTGGGCTCTAAGGAATTGCTCGAGCAATTCCTTAGAGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-1016s21c1
Sequence:CCGGGCTGGAGATAGCTAAGAAGATCTCGAGATCTTCTTAGCTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011876.3-436s21c1
Sequence:CCGGTGCGGCTGAAGATGCTATATGCTCGAGCATATAGCATCTTCAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000322122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-364s21c1
Sequence:CCGGTCCGACTTGATTCGCAGAATGCTCGAGCATTCTGCGAATCAAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011876.3-620s21c1
Sequence:CCGGGATCCGAATCAATGAGGTGAACTCGAGTTCACCTCATTGATTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-734s21c1
Sequence:CCGGACAGAAGACGGTCAACTATATCTCGAGATATAGTTGACCGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011876.3-1324s21c1
Sequence:CCGGCAGGTGGCTGACCATATCTGACTCGAGTCAGATATGGTCAGCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-228s1c1
Sequence:CCGGCGACTTATCAAAGTCATCATTCTCGAGAATGATGACTTTGATAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-899s1c1
Sequence:CCGGCCTTGAATCTGTGGTGTTCATCTCGAGATGAACACCACAGATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-1016s1c1
Sequence:CCGGGCTGGAGATAGCTAAGAAGATCTCGAGATCTTCTTAGCTATCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-620s1c1
Sequence:CCGGGATCCGAATCAATGAGGTGAACTCGAGTTCACCTCATTGATTCGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011876
VALIDATED
TWF2 MISSION shRNA Lentiviral Transduction Particles
twinfilin actin-binding protein 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000363391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011876.3-1281s21c1
Sequence:CCGGAGCCTGGGCTCTAAGGAATTGCTCGAGCAATTCCTTAGAGCCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322121    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-1016s21c1
Sequence:CCGGGCTGGAGATAGCTAAGAAGATCTCGAGATCTTCTTAGCTATCTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322123    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011876.3-436s21c1
Sequence:CCGGTGCGGCTGAAGATGCTATATGCTCGAGCATATAGCATCTTCAGCCGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000322122    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-364s21c1
Sequence:CCGGTCCGACTTGATTCGCAGAATGCTCGAGCATTCTGCGAATCAAGTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011876.3-620s21c1
Sequence:CCGGGATCCGAATCAATGAGGTGAACTCGAGTTCACCTCATTGATTCGGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363385    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011876.3-734s21c1
Sequence:CCGGACAGAAGACGGTCAACTATATCTCGAGATATAGTTGACCGTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011876.3-1324s21c1
Sequence:CCGGCAGGTGGCTGACCATATCTGACTCGAGTCAGATATGGTCAGCCACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023884    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-228s1c1
Sequence:CCGGCGACTTATCAAAGTCATCATTCTCGAGAATGATGACTTTGATAAGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-899s1c1
Sequence:CCGGCCTTGAATCTGTGGTGTTCATCTCGAGATGAACACCACAGATTCAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023888    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-1016s1c1
Sequence:CCGGGCTGGAGATAGCTAAGAAGATCTCGAGATCTTCTTAGCTATCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011876.2-620s1c1
Sequence:CCGGGATCCGAATCAATGAGGTGAACTCGAGTTCACCTCATTGATTCGGATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks