EMAIL THIS PAGE TO A FRIEND

TWIST1

twist basic helix-loop-helix transcription factor 1

Synonyms: ACS3 BPES2 BPES3 CRS1 SCS TWIST bHLHa38
UniProtKB ID: Q15672, A4D128, Q92487, Q99804
Gene ID:
Human(7291) Summary: Basic helix-loop-helix (bHLH) transcription factors have been implicated in cell lineage determination and differentiation. The protein encoded by this gene is a bHLH transcription factor and shares similarity with another bHLH transcription factor, Dermo1. The strongest expression of this mRNA is in placental tissue; in adults, mesodermally derived tissues express this mRNA preferentially. Mutations in this gene have been found in patients with Saethre-Chotzen syndrome. [provided by RefSeq, Jul 2008]
Mouse(22160) twist basic helix-loop-helix transcription factor 1
Rat(85489) twist basic helix-loop-helix transcription factor 1
cow(782170) twist homolog 1 (Drosophila)
sheep(101119467) twist homolog 1 (Drosophila)
naked mole-rat(101705596) twist basic helix-loop-helix transcription factor 1
chicken(395491) twist homolog 1 (Drosophila)
domestic cat(101094007) twist homolog 1 (Drosophila)
Horse(100272214) twist homolog 1 (Drosophila)
domestic cat(100302543) twist homolog 1 (Drosophila)
dog(609156) twist homolog 1 (Drosophila)
Gene Class: Apoptosis
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108515 Anti-TWIST1 IgG fraction of antiserum mouse, zebrafish, rabbit, horse, pig, bovine, human, canine, rat, guinea pig
immunohistochemistry, western blot pricing
SAB1406563 Anti-TWIST1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
T6451 Anti-Twist1 antibody produced in rabbit ~1 mg/mL, affinity isolated antibody, buffered aqueous solution rat, mouse, human
immunofluorescence, western blot pricing
AV37997 Anti-TWIST1 antibody produced in rabbit IgG fraction of antiserum zebrafish, guinea pig, horse, rabbit, canine, human, mouse, rat
western blot pricing
SAB2106420 Anti-TWIST1 antibody produced in rabbit affinity isolated antibody horse, human, rat
ELISA, western blot pricing
SAB1411370 Anti-TWIST1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
WH0007291M1 Monoclonal Anti-TWIST1 antibody produced in mouse clone 3E11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409772 Monoclonal Anti-TWIST1 antibody produced in mouse clone 4G10, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1409773 Monoclonal Anti-TWIST1 antibody produced in mouse clone 1G2, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409774 Monoclonal Anti-TWIST1 antibody produced in mouse clone 4B4, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1409775 Monoclonal Anti-TWIST1 antibody produced in mouse clone 4G11, purified immunoglobulin, buffered aqueous solution human
ELISA pricing
SAB1409776 Monoclonal Anti-TWIST1 antibody produced in mouse clone 2G12, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409777 Monoclonal Anti-TWIST1 antibody produced in mouse clone 1D3, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409778 Monoclonal Anti-TWIST1 antibody produced in mouse clone 3H5, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409779 Monoclonal Anti-TWIST1 antibody produced in mouse clone 3A2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence pricing
SAB1404499 Monoclonal Anti-TWIST1, (C-terminal) antibody produced in mouse clone 2F8, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000474 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000474 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000474 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011658 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011658 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011658 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000474 Rosetta Predictions human pricing
NM_053530 Rosetta Predictions rat pricing
NM_011658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000474 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00048450 predicted 995
2 SASI_Hs01_00048451 predicted 985
3 SASI_Hs01_00048452 predicted 1029
4 SASI_Hs01_00048453 predicted 988
5 SASI_Hs01_00048454 predicted 883
6 SASI_Hs01_00048455 predicted 982
7 SASI_Hs01_00048456 predicted 980
8 SASI_Hs01_00048457 predicted 867
9 SASI_Hs01_00048458 predicted 906
10 SASI_Hs01_00048459 predicted 974
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053530 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105903 predicted 1251
2 SASI_Rn01_00105904 predicted 1196
3 SASI_Rn01_00105905 predicted 815
4 SASI_Rn01_00105906 predicted 1024
5 SASI_Rn01_00105907 predicted 938
6 SASI_Rn01_00105909 predicted 844
7 SASI_Rn01_00105910 predicted 862
8 SASI_Rn01_00105911 predicted 856
9 SASI_Rn02_00266149 predicted 1038
10 SASI_Rn01_00105912 predicted 1017
11 SASI_Rn01_00105908 predicted 1178
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043024 predicted 1319
2 SASI_Mm01_00043025 predicted 959
3 SASI_Mm01_00043026 predicted 1386
4 SASI_Mm01_00043027 predicted 1338
5 SASI_Mm01_00043028 predicted 992
6 SASI_Mm01_00043029 predicted 1073
7 SASI_Mm01_00043030 predicted 1182
8 SASI_Mm01_00043031 predicted 1290
9 SASI_Mm01_00043032 predicted 828
10 SASI_Mm01_00043033 predicted 1183
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000474
TWIST1 MISSION shRNA Bacterial Glycerol Stock
twist basic helix-loop-helix transcription factor 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000020539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000474.2-951s1c1
Sequence:CCGGGCATTCTGATAGAAGTCTGAACTCGAGTTCAGACTTCTATCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-129s1c1
Sequence:CCGGCCTGAGCAACAGCGAGGAAGACTCGAGTCTTCCTCGCTGTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-636s1c1
Sequence:CCGGCGCCTTCTCGGTCTGGAGGATCTCGAGATCCTCCAGACCGAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-378s1c1
Sequence:CCGGTCCGCAGTCTTACGAGGAGCTCTCGAGAGCTCCTCGTAAGACTGCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-582s1c1
Sequence:CCGGGCTGGACTCCAAGATGGCAAGCTCGAGCTTGCCATCTTGGAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-646s21c1
Sequence:CCGGAGTCCGCAGTCTTACGAGGAGCTCGAGCTCCTCGTAAGACTGCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000474.3-1397s21c1
Sequence:CCGGGGAACTATAAGAACACCTTTACTCGAGTAAAGGTGTTCTTATAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000474.3-1046s21c1
Sequence:CCGGCTCTGGAGCTGGATAACTAAACTCGAGTTTAGTTATCCAGCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-776s21c1
Sequence:CCGGAGCTGAGCAAGATTCAGACCCCTCGAGGGGTCTGAATCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-865s21c1
Sequence:CCGGATGGCAAGCTGCAGCTATGTGCTCGAGCACATAGCTGCAGCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000474
TWIST1 MISSION shRNA shRNA Plasmid DNA
twist basic helix-loop-helix transcription factor 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000020539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000474.2-951s1c1
Sequence:CCGGGCATTCTGATAGAAGTCTGAACTCGAGTTCAGACTTCTATCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-129s1c1
Sequence:CCGGCCTGAGCAACAGCGAGGAAGACTCGAGTCTTCCTCGCTGTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-636s1c1
Sequence:CCGGCGCCTTCTCGGTCTGGAGGATCTCGAGATCCTCCAGACCGAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-378s1c1
Sequence:CCGGTCCGCAGTCTTACGAGGAGCTCTCGAGAGCTCCTCGTAAGACTGCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-582s1c1
Sequence:CCGGGCTGGACTCCAAGATGGCAAGCTCGAGCTTGCCATCTTGGAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-646s21c1
Sequence:CCGGAGTCCGCAGTCTTACGAGGAGCTCGAGCTCCTCGTAAGACTGCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000474.3-1397s21c1
Sequence:CCGGGGAACTATAAGAACACCTTTACTCGAGTAAAGGTGTTCTTATAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000474.3-1046s21c1
Sequence:CCGGCTCTGGAGCTGGATAACTAAACTCGAGTTTAGTTATCCAGCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-776s21c1
Sequence:CCGGAGCTGAGCAAGATTCAGACCCCTCGAGGGGTCTGAATCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-865s21c1
Sequence:CCGGATGGCAAGCTGCAGCTATGTGCTCGAGCACATAGCTGCAGCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000474
TWIST1 MISSION shRNA Lentiviral Transduction Particles
twist basic helix-loop-helix transcription factor 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000020539    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000474.2-951s1c1
Sequence:CCGGGCATTCTGATAGAAGTCTGAACTCGAGTTCAGACTTCTATCAGAATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020540    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-129s1c1
Sequence:CCGGCCTGAGCAACAGCGAGGAAGACTCGAGTCTTCCTCGCTGTTGCTCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020541    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-636s1c1
Sequence:CCGGCGCCTTCTCGGTCTGGAGGATCTCGAGATCCTCCAGACCGAGAAGGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020542    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-378s1c1
Sequence:CCGGTCCGCAGTCTTACGAGGAGCTCTCGAGAGCTCCTCGTAAGACTGCGGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020543    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000474.2-582s1c1
Sequence:CCGGGCTGGACTCCAAGATGGCAAGCTCGAGCTTGCCATCTTGGAGTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-646s21c1
Sequence:CCGGAGTCCGCAGTCTTACGAGGAGCTCGAGCTCCTCGTAAGACTGCGGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358496    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000474.3-1397s21c1
Sequence:CCGGGGAACTATAAGAACACCTTTACTCGAGTAAAGGTGTTCTTATAGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367828    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000474.3-1046s21c1
Sequence:CCGGCTCTGGAGCTGGATAACTAAACTCGAGTTTAGTTATCCAGCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367866    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-776s21c1
Sequence:CCGGAGCTGAGCAAGATTCAGACCCCTCGAGGGGTCTGAATCTTGCTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378362    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000474.3-865s21c1
Sequence:CCGGATGGCAAGCTGCAGCTATGTGCTCGAGCACATAGCTGCAGCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011658
TWIST1 MISSION shRNA Bacterial Glycerol Stock
twist basic helix-loop-helix transcription factor 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011658.2-1439s1c1
Sequence:CCGGCCATACTTCCTCTGAAGGAAACTCGAGTTTCCTTCAGAGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-778s1c1
Sequence:CCGGCAGGTACATCGACTTCCTGTACTCGAGTACAGGAAGTCGATGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-682s1c1
Sequence:CCGGGCAGTCGCTGAACGAGGCGTTCTCGAGAACGCCTCGTTCAGCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-733s1c1
Sequence:CCGGGCCCTCGGACAAGCTGAGCAACTCGAGTTGCTCAGCTTGTCCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-749s1c1
Sequence:CCGGAGCAAGATTCAGACCCTCAAACTCGAGTTTGAGGGTCTGAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011658.2-833s21c1
Sequence:CCGGATGGCAAGCTGCAGCTATGTGCTCGAGCACATAGCTGCAGCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-957s21c1
Sequence:CCGGCCGGAGACCTAGATGTCATTGCTCGAGCAATGACATCTAGGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1067s21c1
Sequence:CCGGTAGAAGAGCAGAGACCAAATTCTCGAGAATTTGGTCTCTGCTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1198s21c1
Sequence:CCGGAGAAGTCTGAACACTCGTTTGCTCGAGCAAACGAGTGTTCAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1012s21c1
Sequence:CCGGCTCTGGAGCTGGATAACTAAACTCGAGTTTAGTTATCCAGCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011658
TWIST1 MISSION shRNA shRNA Plasmid DNA
twist basic helix-loop-helix transcription factor 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011658.2-1439s1c1
Sequence:CCGGCCATACTTCCTCTGAAGGAAACTCGAGTTTCCTTCAGAGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-778s1c1
Sequence:CCGGCAGGTACATCGACTTCCTGTACTCGAGTACAGGAAGTCGATGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-682s1c1
Sequence:CCGGGCAGTCGCTGAACGAGGCGTTCTCGAGAACGCCTCGTTCAGCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-733s1c1
Sequence:CCGGGCCCTCGGACAAGCTGAGCAACTCGAGTTGCTCAGCTTGTCCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-749s1c1
Sequence:CCGGAGCAAGATTCAGACCCTCAAACTCGAGTTTGAGGGTCTGAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011658.2-833s21c1
Sequence:CCGGATGGCAAGCTGCAGCTATGTGCTCGAGCACATAGCTGCAGCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-957s21c1
Sequence:CCGGCCGGAGACCTAGATGTCATTGCTCGAGCAATGACATCTAGGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1067s21c1
Sequence:CCGGTAGAAGAGCAGAGACCAAATTCTCGAGAATTTGGTCTCTGCTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1198s21c1
Sequence:CCGGAGAAGTCTGAACACTCGTTTGCTCGAGCAAACGAGTGTTCAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1012s21c1
Sequence:CCGGCTCTGGAGCTGGATAACTAAACTCGAGTTTAGTTATCCAGCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011658
TWIST1 MISSION shRNA Lentiviral Transduction Particles
twist basic helix-loop-helix transcription factor 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095074    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011658.2-1439s1c1
Sequence:CCGGCCATACTTCCTCTGAAGGAAACTCGAGTTTCCTTCAGAGGAAGTATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095078    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-778s1c1
Sequence:CCGGCAGGTACATCGACTTCCTGTACTCGAGTACAGGAAGTCGATGTACCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095075    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-682s1c1
Sequence:CCGGGCAGTCGCTGAACGAGGCGTTCTCGAGAACGCCTCGTTCAGCGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095076    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-733s1c1
Sequence:CCGGGCCCTCGGACAAGCTGAGCAACTCGAGTTGCTCAGCTTGTCCGAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095077    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011658.2-749s1c1
Sequence:CCGGAGCAAGATTCAGACCCTCAAACTCGAGTTTGAGGGTCTGAATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271139    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011658.2-833s21c1
Sequence:CCGGATGGCAAGCTGCAGCTATGTGCTCGAGCACATAGCTGCAGCTTGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271138    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-957s21c1
Sequence:CCGGCCGGAGACCTAGATGTCATTGCTCGAGCAATGACATCTAGGTCTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271189    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1067s21c1
Sequence:CCGGTAGAAGAGCAGAGACCAAATTCTCGAGAATTTGGTCTCTGCTCTTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271188    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1198s21c1
Sequence:CCGGAGAAGTCTGAACACTCGTTTGCTCGAGCAAACGAGTGTTCAGACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284330    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011658.2-1012s21c1
Sequence:CCGGCTCTGGAGCTGGATAACTAAACTCGAGTTTAGTTATCCAGCTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks