EMAIL THIS PAGE TO A FRIEND

TWIST2

twist basic helix-loop-helix transcription factor 2

Synonyms: DERMO1 FFDD3 SETLSS bHLHa39
UniProtKB ID: Q8WVJ9, Q3SYL6
Gene ID:
Human(117581) Summary: Basic helix-loop-helix (bHLH) transcription factors have been implicated in cell lineage determination and differentiation. The protein encoded by this gene is a bHLH transcription factor and shares similarity with another bHLH transcription factor, Twist. It is thought that during osteoblast development this protein may inhibit osteoblast maturation and maintain cells in a preosteoblast phenotype. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2012]
Mouse(13345) twist basic helix-loop-helix transcription factor 2
Rat(59327) twist basic helix-loop-helix transcription factor 2
dog(486185) twist homolog 2 (Drosophila)
chicken(395405) twist homolog 2 (Drosophila)
naked mole-rat(101726758) twist basic helix-loop-helix transcription factor 2
domestic guinea pig(100727602) twist basic helix-loop-helix transcription factor 2
cow(540060) twist homolog 2 (Drosophila)
sheep(101122639) twist homolog 2 (Drosophila)
58 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_057179 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_057179 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_057179 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_007855 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007855 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007855 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_057179 Rosetta Predictions human pricing
NM_021691 Rosetta Predictions rat pricing
NM_007855 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_057179 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00362046 predicted 683
2 SASI_Hs01_00096046 predicted 681
3 SASI_Hs02_00362047 predicted 552
4 SASI_Hs01_00096047 predicted 912
5 SASI_Hs01_00096049 predicted 670
6 SASI_Hs01_00096050 predicted 841
7 SASI_Hs01_00096051 predicted 981
8 SASI_Hs01_00096052 predicted 936
9 SASI_Hs01_00096053 predicted 851
10 SASI_Hs02_00362048 predicted 499
11 SASI_Hs01_00096044 predicted 949
12 SASI_Hs01_00096045 predicted 962
13 SASI_Hs01_00096048 predicted 950
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021691 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00262722 predicted 518
2 SASI_Rn01_00049105 predicted 310
3 SASI_Rn02_00262723 predicted 430
4 SASI_Rn01_00049108 predicted 397
5 SASI_Rn01_00049109 predicted 327
6 SASI_Rn01_00049110 predicted 398
7 SASI_Rn02_00262724 predicted 528
8 SASI_Rn01_00049111 predicted 290
9 SASI_Rn02_00262725 predicted 401
10 SASI_Rn02_00262726 predicted 543
11 SASI_Rn01_00049104 predicted 364
12 SASI_Rn01_00049106 predicted 319
13 SASI_Rn01_00049107 predicted 333
14 SASI_Rn01_00049112 predicted 360
15 SASI_Rn01_00049113 predicted 368
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007855 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00024106 predicted 934
2 SASI_Mm01_00024109 predicted 1015
3 SASI_Mm01_00024110 predicted 545
4 SASI_Mm01_00024111 predicted 478
5 SASI_Mm01_00024112 predicted 441
6 SASI_Mm01_00024114 predicted 250
7 SASI_Mm02_00312625 predicted 558
8 SASI_Mm01_00024115 predicted 676
9 SASI_Mm02_00312626 predicted 1083
10 SASI_Mm01_00024113 predicted 963
11 SASI_Mm01_00024107 predicted 952
12 SASI_Mm01_00024108 predicted 979
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_057179
VALIDATED
TWIST2 MISSION shRNA Bacterial Glycerol Stock
twist basic helix-loop-helix transcription factor 2
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000274897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-302s21c1
Sequence:CCGGCGCGCAGTCCTTCGAGGAGCTCTCGAGAGCTCCTCGAAGGACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-563s21c1
Sequence:CCGGCTTCTCCGTGTGGCGCATGGACTCGAGTCCATGCGCCACACGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057179.1-1037s21c1
Sequence:CCGGGAAATGCATTCTTGTACAATTCTCGAGAATTGTACAAGAATGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057179.1-947s21c1
Sequence:CCGGAGATTCAGGAACACATTTATGCTCGAGCATAAATGTGTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000274900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-500s21c1
Sequence:CCGGCGACGAGATGGACAATAAGATCTCGAGATCTTATTGTCCATCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057179.1-508s1c1
Sequence:CCGGTGGACAATAAGATGACCAGCTCTCGAGAGCTGGTCATCTTATTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057179.1-302s1c1
Sequence:CCGGCGCGCAGTCCTTCGAGGAGCTCTCGAGAGCTCCTCGAAGGACTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-237s1c1
Sequence:CCGGAGCAAGAAGTCGAGCGAAGATCTCGAGATCTTCGCTCGACTTCTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-563s1c1
Sequence:CCGGCTTCTCCGTGTGGCGCATGGACTCGAGTCCATGCGCCACACGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000020869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-500s1c1
Sequence:CCGGCGACGAGATGGACAATAAGATCTCGAGATCTTATTGTCCATCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_057179
VALIDATED
TWIST2 MISSION shRNA shRNA Plasmid DNA
twist basic helix-loop-helix transcription factor 2
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000274897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-302s21c1
Sequence:CCGGCGCGCAGTCCTTCGAGGAGCTCTCGAGAGCTCCTCGAAGGACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-563s21c1
Sequence:CCGGCTTCTCCGTGTGGCGCATGGACTCGAGTCCATGCGCCACACGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057179.1-1037s21c1
Sequence:CCGGGAAATGCATTCTTGTACAATTCTCGAGAATTGTACAAGAATGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057179.1-947s21c1
Sequence:CCGGAGATTCAGGAACACATTTATGCTCGAGCATAAATGTGTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000274900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-500s21c1
Sequence:CCGGCGACGAGATGGACAATAAGATCTCGAGATCTTATTGTCCATCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057179.1-508s1c1
Sequence:CCGGTGGACAATAAGATGACCAGCTCTCGAGAGCTGGTCATCTTATTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057179.1-302s1c1
Sequence:CCGGCGCGCAGTCCTTCGAGGAGCTCTCGAGAGCTCCTCGAAGGACTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-237s1c1
Sequence:CCGGAGCAAGAAGTCGAGCGAAGATCTCGAGATCTTCGCTCGACTTCTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-563s1c1
Sequence:CCGGCTTCTCCGTGTGGCGCATGGACTCGAGTCCATGCGCCACACGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000020869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-500s1c1
Sequence:CCGGCGACGAGATGGACAATAAGATCTCGAGATCTTATTGTCCATCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_057179
VALIDATED
TWIST2 MISSION shRNA Lentiviral Transduction Particles
twist basic helix-loop-helix transcription factor 2
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000274897    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-302s21c1
Sequence:CCGGCGCGCAGTCCTTCGAGGAGCTCTCGAGAGCTCCTCGAAGGACTGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274837    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-563s21c1
Sequence:CCGGCTTCTCCGTGTGGCGCATGGACTCGAGTCCATGCGCCACACGGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274836    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057179.1-1037s21c1
Sequence:CCGGGAAATGCATTCTTGTACAATTCTCGAGAATTGTACAAGAATGCATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274898    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_057179.1-947s21c1
Sequence:CCGGAGATTCAGGAACACATTTATGCTCGAGCATAAATGTGTTCCTGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000274900    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_057179.1-500s21c1
Sequence:CCGGCGACGAGATGGACAATAAGATCTCGAGATCTTATTGTCCATCTCGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057179.1-508s1c1
Sequence:CCGGTGGACAATAAGATGACCAGCTCTCGAGAGCTGGTCATCTTATTGTCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_057179.1-302s1c1
Sequence:CCGGCGCGCAGTCCTTCGAGGAGCTCTCGAGAGCTCCTCGAAGGACTGCGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-237s1c1
Sequence:CCGGAGCAAGAAGTCGAGCGAAGATCTCGAGATCTTCGCTCGACTTCTTGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020873    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-563s1c1
Sequence:CCGGCTTCTCCGTGTGGCGCATGGACTCGAGTCCATGCGCCACACGGAGAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000020869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_057179.1-500s1c1
Sequence:CCGGCGACGAGATGGACAATAAGATCTCGAGATCTTATTGTCCATCTCGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007855
VALIDATED
TWIST2 MISSION shRNA Bacterial Glycerol Stock
twist basic helix-loop-helix transcription factor 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-456s21c1
Sequence:CCGGCAAGATCCAGACGCTCAAGCTCTCGAGAGCTTGAGCGTCTGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007855.2-1134s21c1
Sequence:CCGGCCCGCATACTCCTGTTCTTTACTCGAGTAAAGAACAGGAGTATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-491s21c1
Sequence:CCGGTAGACTTCCTCTACCAGGTTCCTCGAGGAACCTGGTAGAGGAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-517s21c1
Sequence:CCGGAGCGACGAGATGGACAATAAGCTCGAGCTTATTGTCCATCTCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007855.1-1024s1c1
Sequence:CCGGGCATTCTTGTAGAACCTGTTTCTCGAGAAACAGGTTCTACAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-256s1c1
Sequence:CCGGAGCAAGAAATCGAGCGAAGATCTCGAGATCTTCGCTCGATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-387s1c1
Sequence:CCGGCCAGTCGCTCAACGAGGCCTTCTCGAGAAGGCCTCGTTGAGCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000086084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-516s1c1
Sequence:CCGGGAGCGACGAGATGGACAATAACTCGAGTTATTGTCCATCTCGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007855
VALIDATED
TWIST2 MISSION shRNA shRNA Plasmid DNA
twist basic helix-loop-helix transcription factor 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-456s21c1
Sequence:CCGGCAAGATCCAGACGCTCAAGCTCTCGAGAGCTTGAGCGTCTGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007855.2-1134s21c1
Sequence:CCGGCCCGCATACTCCTGTTCTTTACTCGAGTAAAGAACAGGAGTATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-491s21c1
Sequence:CCGGTAGACTTCCTCTACCAGGTTCCTCGAGGAACCTGGTAGAGGAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-517s21c1
Sequence:CCGGAGCGACGAGATGGACAATAAGCTCGAGCTTATTGTCCATCTCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007855.1-1024s1c1
Sequence:CCGGGCATTCTTGTAGAACCTGTTTCTCGAGAAACAGGTTCTACAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-256s1c1
Sequence:CCGGAGCAAGAAATCGAGCGAAGATCTCGAGATCTTCGCTCGATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-387s1c1
Sequence:CCGGCCAGTCGCTCAACGAGGCCTTCTCGAGAAGGCCTCGTTGAGCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000086084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-516s1c1
Sequence:CCGGGAGCGACGAGATGGACAATAACTCGAGTTATTGTCCATCTCGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007855
VALIDATED
TWIST2 MISSION shRNA Lentiviral Transduction Particles
twist basic helix-loop-helix transcription factor 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235774    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-456s21c1
Sequence:CCGGCAAGATCCAGACGCTCAAGCTCTCGAGAGCTTGAGCGTCTGGATCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235773    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007855.2-1134s21c1
Sequence:CCGGCCCGCATACTCCTGTTCTTTACTCGAGTAAAGAACAGGAGTATGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-491s21c1
Sequence:CCGGTAGACTTCCTCTACCAGGTTCCTCGAGGAACCTGGTAGAGGAAGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257292    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007855.2-517s21c1
Sequence:CCGGAGCGACGAGATGGACAATAAGCTCGAGCTTATTGTCCATCTCGTCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086083    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007855.1-1024s1c1
Sequence:CCGGGCATTCTTGTAGAACCTGTTTCTCGAGAAACAGGTTCTACAAGAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086085    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-256s1c1
Sequence:CCGGAGCAAGAAATCGAGCGAAGATCTCGAGATCTTCGCTCGATTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086086    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-387s1c1
Sequence:CCGGCCAGTCGCTCAACGAGGCCTTCTCGAGAAGGCCTCGTTGAGCGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000086084    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_007855.1-516s1c1
Sequence:CCGGGAGCGACGAGATGGACAATAACTCGAGTTATTGTCCATCTCGTCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks