EMAIL THIS PAGE TO A FRIEND

TWISTNB

TWIST neighbor

UniProtKB ID: Q3B726, A0PJ45, B7Z724
Gene ID:
Mouse(28071) TWIST neighbor
Rat(362728) TWIST neighbor
Zebrafish(402856) TWIST neighbor
Horse(100053319) TWIST neighbor
domestic cat(101086962) TWIST neighbor
chicken(420603) TWIST neighbor
dog(610923) TWIST neighbor
cow(512375) TWIST neighbor
sheep(101106766) TWIST neighbor
naked mole-rat(101704623) TWIST neighbor
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_166508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_166508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_166508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172253 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172253 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172253 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001002926 Rosetta Predictions human pricing
NM_001108707 Rosetta Predictions rat pricing
NM_172253 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001002926 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110621 predicted 400
2 SASI_Hs01_00110623 predicted 1262
3 SASI_Hs01_00110624 predicted 410
4 SASI_Hs01_00110625 predicted 1333
5 SASI_Hs02_00304282 predicted 323
6 SASI_Hs01_00110626 predicted 318
7 SASI_Hs01_00110627 predicted 397
8 SASI_Hs01_00110628 predicted 348
9 SASI_Hs01_00110629 predicted 433
10 SASI_Hs02_00304283 predicted 1412
11 SASI_Hs01_00110620 predicted 225
12 SASI_Hs01_00110622 predicted 255
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108707 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00241285 predicted 516
2 SASI_Rn02_00241286 predicted 210
3 SASI_Rn02_00241287 predicted 423
4 SASI_Rn02_00241288 predicted 1111
5 SASI_Rn02_00241289 predicted 481
6 SASI_Rn02_00241290 predicted 654
7 SASI_Rn02_00241291 predicted 890
8 SASI_Rn02_00241292 predicted 832
9 SASI_Rn02_00241293 predicted 1050
10 SASI_Rn02_00241294 predicted 703
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172253 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00040290 predicted 417
2 SASI_Mm01_00040293 predicted 417
3 SASI_Mm01_00040291 predicted 353
4 SASI_Mm01_00040292 predicted 310
5 SASI_Mm01_00040294 predicted 996
6 SASI_Mm01_00040295 predicted 1089
7 SASI_Mm01_00040296 predicted 822
8 SASI_Mm01_00040297 predicted 803
9 SASI_Mm01_00040298 predicted 1090
10 SASI_Mm01_00040299 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_166508
VALIDATED
TWISTNB MISSION shRNA Bacterial Glycerol Stock
TWIST neighbor
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000015208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-452s1c1
Sequence:CCGGGCTGTTTAGTACATGGGTGTTCTCGAGAACACCCATGTACTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166508.5-640s1c1
Sequence:CCGGCGCTCTGAAGTTTCTGAAGAACTCGAGTTCTTCAGAAACTTCAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166508.5-804s1c1
Sequence:CCGGGCAGAATACTAATAATGCGAACTCGAGTTCGCATTATTAGTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-288s1c1
Sequence:CCGGCCCTATTGCATATGATAACATCTCGAGATGTTATCATATGCAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000015211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-583s1c1
Sequence:CCGGGCTGCTGGAGTATTCTGCATTCTCGAGAATGCAGAATACTCCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_166508
VALIDATED
TWISTNB MISSION shRNA shRNA Plasmid DNA
TWIST neighbor
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000015208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-452s1c1
Sequence:CCGGGCTGTTTAGTACATGGGTGTTCTCGAGAACACCCATGTACTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166508.5-640s1c1
Sequence:CCGGCGCTCTGAAGTTTCTGAAGAACTCGAGTTCTTCAGAAACTTCAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166508.5-804s1c1
Sequence:CCGGGCAGAATACTAATAATGCGAACTCGAGTTCGCATTATTAGTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-288s1c1
Sequence:CCGGCCCTATTGCATATGATAACATCTCGAGATGTTATCATATGCAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000015211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-583s1c1
Sequence:CCGGGCTGCTGGAGTATTCTGCATTCTCGAGAATGCAGAATACTCCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_166508
VALIDATED
TWISTNB MISSION shRNA Lentiviral Transduction Particles
TWIST neighbor
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000015208    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-452s1c1
Sequence:CCGGGCTGTTTAGTACATGGGTGTTCTCGAGAACACCCATGTACTAAACAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015209    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166508.5-640s1c1
Sequence:CCGGCGCTCTGAAGTTTCTGAAGAACTCGAGTTCTTCAGAAACTTCAGAGCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015210    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_166508.5-804s1c1
Sequence:CCGGGCAGAATACTAATAATGCGAACTCGAGTTCGCATTATTAGTATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-288s1c1
Sequence:CCGGCCCTATTGCATATGATAACATCTCGAGATGTTATCATATGCAATAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000015211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:XM_166508.5-583s1c1
Sequence:CCGGGCTGCTGGAGTATTCTGCATTCTCGAGAATGCAGAATACTCCAGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172253
TWISTNB MISSION shRNA Bacterial Glycerol Stock
TWIST neighbor
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000197753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172253.1-306s1c1
Sequence:CCGGGCATATGATAACATCAGAGTTCTCGAGAACTCTGATGTTATCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172253.1-1091s1c1
Sequence:CCGGCTTATGGGACATTCACAAATACTCGAGTATTTGTGAATGTCCCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-678s1c1
Sequence:CCGGGAAACTGTCGTTGAAGAGGTTCTCGAGAACCTCTTCAACGACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-817s1c1
Sequence:CCGGCAGACATACCATGTAGTGATACTCGAGTATCACTACATGGTATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172253.1-1051s1c1
Sequence:CCGGCAGATACACGAGGAATAGATTCTCGAGAATCTATTCCTCGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-825s1c1
Sequence:CCGGCCATGTAGTGATAATGTGAATCTCGAGATTCACATTATCACTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172253
TWISTNB MISSION shRNA shRNA Plasmid DNA
TWIST neighbor
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000197753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172253.1-306s1c1
Sequence:CCGGGCATATGATAACATCAGAGTTCTCGAGAACTCTGATGTTATCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172253.1-1091s1c1
Sequence:CCGGCTTATGGGACATTCACAAATACTCGAGTATTTGTGAATGTCCCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-678s1c1
Sequence:CCGGGAAACTGTCGTTGAAGAGGTTCTCGAGAACCTCTTCAACGACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-817s1c1
Sequence:CCGGCAGACATACCATGTAGTGATACTCGAGTATCACTACATGGTATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172253.1-1051s1c1
Sequence:CCGGCAGATACACGAGGAATAGATTCTCGAGAATCTATTCCTCGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-825s1c1
Sequence:CCGGCCATGTAGTGATAATGTGAATCTCGAGATTCACATTATCACTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172253
TWISTNB MISSION shRNA Lentiviral Transduction Particles
TWIST neighbor
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000197753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172253.1-306s1c1
Sequence:CCGGGCATATGATAACATCAGAGTTCTCGAGAACTCTGATGTTATCATATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197633    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172253.1-1091s1c1
Sequence:CCGGCTTATGGGACATTCACAAATACTCGAGTATTTGTGAATGTCCCATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178118    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-678s1c1
Sequence:CCGGGAAACTGTCGTTGAAGAGGTTCTCGAGAACCTCTTCAACGACAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-817s1c1
Sequence:CCGGCAGACATACCATGTAGTGATACTCGAGTATCACTACATGGTATGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177512    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172253.1-1051s1c1
Sequence:CCGGCAGATACACGAGGAATAGATTCTCGAGAATCTATTCCTCGTGTATCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177587    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172253.1-825s1c1
Sequence:CCGGCCATGTAGTGATAATGTGAATCTCGAGATTCACATTATCACTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks