EMAIL THIS PAGE TO A FRIEND

TWSG1

twisted gastrulation homolog 1 (Drosophila)

Synonyms: TSG
UniProtKB ID: Q9GZX9, B2RE08, D3DUH9, Q8NBI7, Q96K46
Gene ID:
Mouse(65960) twisted gastrulation homolog 1 (Drosophila)
Rat(363294) twisted gastrulation homolog 1 (Drosophila)
chicken(374024) twisted gastrulation homolog 1 (Drosophila)
dog(490546) twisted gastrulation homolog 1 (Drosophila)
domestic cat(101101257) twisted gastrulation homolog 1 (Drosophila)
cow(537290) twisted gastrulation homolog 1 (Drosophila)
sheep(101107404) twisted gastrulation homolog 1 (Drosophila)
naked mole-rat(101712397) twisted gastrulation homolog 1 (Drosophila)
domestic guinea pig(100718461) twisted gastrulation homolog 1 (Drosophila)
163 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023053 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023053 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023053 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_020648 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020648 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020648 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020648 Rosetta Predictions human pricing
NM_001108811 Rosetta Predictions rat pricing
XM_343637 Rosetta Predictions rat pricing
NM_023053 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020648 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00075752 predicted 595
2 SASI_Hs02_00353626 predicted 248
3 SASI_Hs01_00075753 predicted 674
4 SASI_Hs01_00075754 predicted 827
5 SASI_Hs01_00075755 predicted 625
6 SASI_Hs01_00075756 predicted 844
7 SASI_Hs01_00075757 predicted 701
8 SASI_Hs01_00075758 predicted 454
9 SASI_Hs01_00075759 predicted 429
10 SASI_Hs01_00075760 predicted 195
11 SASI_Hs01_00075761 predicted 787
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108811 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242305 predicted 932
2 SASI_Rn02_00242306 predicted 914
3 SASI_Rn02_00242307 predicted 1200
4 SASI_Rn02_00242308 predicted 1167
5 SASI_Rn02_00242309 predicted 946
6 SASI_Rn02_00242310 predicted 797
7 SASI_Rn02_00242311 predicted 898
8 SASI_Rn02_00242312 predicted 1254
9 SASI_Rn02_00242313 predicted 1180
10 SASI_Rn02_00242314 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343637 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00179857 predicted 365
2 SASI_Rn01_00179858 predicted 332
3 SASI_Rn01_00179859 predicted 320
4 SASI_Rn01_00179860 predicted 319
5 SASI_Rn01_00179861 predicted 342
6 SASI_Rn01_00179862 predicted 229
7 SASI_Rn01_00179863 predicted 369
8 SASI_Rn01_00179864 predicted 322
9 SASI_Rn01_00179865 predicted 320
10 SASI_Rn01_00179866 predicted 348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023053 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00157444 predicted 754
2 SASI_Mm01_00157445 predicted 1164
3 SASI_Mm02_00326753 predicted 1151
4 SASI_Mm01_00157446 predicted 670
5 SASI_Mm01_00157447 predicted 1088
6 SASI_Mm01_00157449 predicted 1068
7 SASI_Mm01_00157450 predicted 1155
8 SASI_Mm01_00157451 predicted 894
9 SASI_Mm01_00157452 predicted 1179
10 SASI_Mm01_00157453 predicted 1193
11 SASI_Mm01_00157448 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023053
VALIDATED
TWSG1 MISSION shRNA Bacterial Glycerol Stock
twisted gastrulation homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023053.1-182s1c1
Sequence:CCGGGTAACAAAGCACTCTGTGCCACTCGAGTGGCACAGAGTGCTTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023053.1-635s1c1
Sequence:CCGGCCATCCACCAGTGTAAGATATCTCGAGATATCTTACACTGGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-501s21c1
Sequence:CCGGCCTAGTCTCCTTCCTAGAAACCTCGAGGTTTCTAGGAAGGAGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-331s21c1
Sequence:CCGGATGTGCAACCCTCGGAATTACCTCGAGGTAATTCCGAGGGTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-2135s21c1
Sequence:CCGGACACGCCCTTCCTAGTAATAACTCGAGTTATTACTAGGAAGGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-665s21c1
Sequence:CCGGCCATGGGTGCATCCAAGTATCCTCGAGGATACTTGGATGCACCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-719s21c1
Sequence:CCGGGTCCAGAGTGCATTGACTATGCTCGAGCATAGTCAATGCACTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023053
VALIDATED
TWSG1 MISSION shRNA shRNA Plasmid DNA
twisted gastrulation homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023053.1-182s1c1
Sequence:CCGGGTAACAAAGCACTCTGTGCCACTCGAGTGGCACAGAGTGCTTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023053.1-635s1c1
Sequence:CCGGCCATCCACCAGTGTAAGATATCTCGAGATATCTTACACTGGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-501s21c1
Sequence:CCGGCCTAGTCTCCTTCCTAGAAACCTCGAGGTTTCTAGGAAGGAGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-331s21c1
Sequence:CCGGATGTGCAACCCTCGGAATTACCTCGAGGTAATTCCGAGGGTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-2135s21c1
Sequence:CCGGACACGCCCTTCCTAGTAATAACTCGAGTTATTACTAGGAAGGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-665s21c1
Sequence:CCGGCCATGGGTGCATCCAAGTATCCTCGAGGATACTTGGATGCACCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-719s21c1
Sequence:CCGGGTCCAGAGTGCATTGACTATGCTCGAGCATAGTCAATGCACTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023053
VALIDATED
TWSG1 MISSION shRNA Lentiviral Transduction Particles
twisted gastrulation homolog 1 (Drosophila)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201700    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023053.1-182s1c1
Sequence:CCGGGTAACAAAGCACTCTGTGCCACTCGAGTGGCACAGAGTGCTTTGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192453    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023053.1-635s1c1
Sequence:CCGGCCATCCACCAGTGTAAGATATCTCGAGATATCTTACACTGGTGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248494    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-501s21c1
Sequence:CCGGCCTAGTCTCCTTCCTAGAAACCTCGAGGTTTCTAGGAAGGAGACTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-331s21c1
Sequence:CCGGATGTGCAACCCTCGGAATTACCTCGAGGTAATTCCGAGGGTTGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248497    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-2135s21c1
Sequence:CCGGACACGCCCTTCCTAGTAATAACTCGAGTTATTACTAGGAAGGGCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248495    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-665s21c1
Sequence:CCGGCCATGGGTGCATCCAAGTATCCTCGAGGATACTTGGATGCACCCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248496    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023053.2-719s21c1
Sequence:CCGGGTCCAGAGTGCATTGACTATGCTCGAGCATAGTCAATGCACTCTGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020648
VALIDATED
TWSG1 MISSION shRNA Bacterial Glycerol Stock
twisted gastrulation homolog 1 (Drosophila)
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020648.3-2528s1c1
Sequence:CCGGGCTGAAAGTATTCTGGAACTTCTCGAGAAGTTCCAGAATACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-319s1c1
Sequence:CCGGGACTGTGTTGGTATGTGTAATCTCGAGATTACACATACCAACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020648.3-1115s1c1
Sequence:CCGGGCTTTGAAAGTGTTAGCAGAACTCGAGTTCTGCTAACACTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-472s1c1
Sequence:CCGGGTTGCAGAAGAACTTTCACATCTCGAGATGTGAAAGTTCTTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-475s1c1
Sequence:CCGGGCAGAAGAACTTTCACATCATCTCGAGATGATGTGAAAGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-169s1c1
Sequence:CCGGGAATCACTGAGCTGTAACAAACTCGAGTTTGTTACAGCTCAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-1816s1c1
Sequence:CCGGGCTGGGAATTATAATGGGAAACTCGAGTTTCCCATTATAATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-576s1c1
Sequence:CCGGGCCTTATTCCAGTGACAAAGACTCGAGTCTTTGTCACTGGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-622s1c1
Sequence:CCGGGATGACTGCATGTCCATACATCTCGAGATGTATGGACATGCAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-2517s1c1
Sequence:CCGGGCATCTGTAGAGCTGAAAGTACTCGAGTACTTTCAGCTCTACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-205s1c1
Sequence:CCGGGATGTGAGCAAATGCCTCATTCTCGAGAATGAGGCATTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-629s1c1
Sequence:CCGGGCATGTCCATACATCAGTGTACTCGAGTACACTGATGTATGGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-574s1c1
Sequence:CCGGGCGCCTTATTCCAGTGACAAACTCGAGTTTGTCACTGGAATAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020648
VALIDATED
TWSG1 MISSION shRNA shRNA Plasmid DNA
twisted gastrulation homolog 1 (Drosophila)
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020648.3-2528s1c1
Sequence:CCGGGCTGAAAGTATTCTGGAACTTCTCGAGAAGTTCCAGAATACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-319s1c1
Sequence:CCGGGACTGTGTTGGTATGTGTAATCTCGAGATTACACATACCAACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020648.3-1115s1c1
Sequence:CCGGGCTTTGAAAGTGTTAGCAGAACTCGAGTTCTGCTAACACTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-472s1c1
Sequence:CCGGGTTGCAGAAGAACTTTCACATCTCGAGATGTGAAAGTTCTTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-475s1c1
Sequence:CCGGGCAGAAGAACTTTCACATCATCTCGAGATGATGTGAAAGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-169s1c1
Sequence:CCGGGAATCACTGAGCTGTAACAAACTCGAGTTTGTTACAGCTCAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-1816s1c1
Sequence:CCGGGCTGGGAATTATAATGGGAAACTCGAGTTTCCCATTATAATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-576s1c1
Sequence:CCGGGCCTTATTCCAGTGACAAAGACTCGAGTCTTTGTCACTGGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-622s1c1
Sequence:CCGGGATGACTGCATGTCCATACATCTCGAGATGTATGGACATGCAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-2517s1c1
Sequence:CCGGGCATCTGTAGAGCTGAAAGTACTCGAGTACTTTCAGCTCTACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-205s1c1
Sequence:CCGGGATGTGAGCAAATGCCTCATTCTCGAGAATGAGGCATTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-629s1c1
Sequence:CCGGGCATGTCCATACATCAGTGTACTCGAGTACACTGATGTATGGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-574s1c1
Sequence:CCGGGCGCCTTATTCCAGTGACAAACTCGAGTTTGTCACTGGAATAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020648
VALIDATED
TWSG1 MISSION shRNA Lentiviral Transduction Particles
twisted gastrulation homolog 1 (Drosophila)
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145279    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020648.3-2528s1c1
Sequence:CCGGGCTGAAAGTATTCTGGAACTTCTCGAGAAGTTCCAGAATACTTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-319s1c1
Sequence:CCGGGACTGTGTTGGTATGTGTAATCTCGAGATTACACATACCAACACAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144982    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_020648.3-1115s1c1
Sequence:CCGGGCTTTGAAAGTGTTAGCAGAACTCGAGTTCTGCTAACACTTTCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-472s1c1
Sequence:CCGGGTTGCAGAAGAACTTTCACATCTCGAGATGTGAAAGTTCTTCTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144633    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-475s1c1
Sequence:CCGGGCAGAAGAACTTTCACATCATCTCGAGATGATGTGAAAGTTCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-169s1c1
Sequence:CCGGGAATCACTGAGCTGTAACAAACTCGAGTTTGTTACAGCTCAGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144632    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-1816s1c1
Sequence:CCGGGCTGGGAATTATAATGGGAAACTCGAGTTTCCCATTATAATTCCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143868    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-576s1c1
Sequence:CCGGGCCTTATTCCAGTGACAAAGACTCGAGTCTTTGTCACTGGAATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143713    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-622s1c1
Sequence:CCGGGATGACTGCATGTCCATACATCTCGAGATGTATGGACATGCAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143264    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-2517s1c1
Sequence:CCGGGCATCTGTAGAGCTGAAAGTACTCGAGTACTTTCAGCTCTACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143526    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-205s1c1
Sequence:CCGGGATGTGAGCAAATGCCTCATTCTCGAGAATGAGGCATTTGCTCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143265    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_020648.3-629s1c1
Sequence:CCGGGCATGTCCATACATCAGTGTACTCGAGTACACTGATGTATGGACATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122458    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_020648.3-574s1c1
Sequence:CCGGGCGCCTTATTCCAGTGACAAACTCGAGTTTGTCACTGGAATAAGGCGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks