EMAIL THIS PAGE TO A FRIEND

TXK

TXK tyrosine kinase

Synonyms: BTKL PSCTK5 PTK4 RLK TKL
UniProtKB ID: P42681, Q14220
Gene ID:
Mouse(22165) TXK tyrosine kinase
Rat(305311) TXK tyrosine kinase
chicken(770387) TXK tyrosine kinase
domestic cat(101095739) TXK tyrosine kinase
Horse(100054343) TXK tyrosine kinase
dog(482139) TXK tyrosine kinase
domestic guinea pig(100722451) TXK tyrosine kinase
naked mole-rat(101713820) TXK tyrosine kinase
Domestic Rabbit(100341671) TXK tyrosine kinase
cow(504782) TXK tyrosine kinase
sheep(101102237) TXK tyrosine kinase
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
T5568 Tyrphostin AG 835 ≥92% human pricing
T5318 Tyrphostin AG 808 ≥98% human, mouse pricing

ELISA

Product # Description Species Add to Cart
 
RAB1005 Phosphotyrosine TXK / Tyrosine-protein Kinase TXK ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013698 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013698 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013698 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003328 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003328 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003328 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU052171 MISSION® esiRNA esiRNA human TXK (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003328 Rosetta Predictions human pricing
NM_001024255 Rosetta Predictions rat pricing
NM_001122754 Rosetta Predictions mouse pricing
NM_013698 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003328 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00124796 predicted 1653
2 SASI_Hs01_00124797 predicted 907
3 SASI_Hs01_00124798 predicted 877
4 SASI_Hs01_00124800 predicted 948
5 SASI_Hs01_00124801 predicted 975
6 SASI_Hs01_00124802 predicted 923
7 SASI_Hs01_00124803 predicted 1279
8 SASI_Hs02_00335474 predicted 756
9 SASI_Hs01_00124804 predicted 1767
10 SASI_Hs01_00124805 predicted 744
11 SASI_Hs01_00124799 predicted 1693
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024255 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059985 predicted 586
2 SASI_Rn01_00059987 predicted 1680
3 SASI_Rn02_00202416 predicted 1071
4 SASI_Rn01_00059989 predicted 912
5 SASI_Rn02_00202417 predicted 584
6 SASI_Rn01_00059990 predicted 1036
7 SASI_Rn01_00059991 predicted 708
8 SASI_Rn01_00059992 predicted 1566
9 SASI_Rn01_00059993 predicted 1062
10 SASI_Rn01_00059994 predicted 1353
11 SASI_Rn01_00059986 predicted 961
12 SASI_Rn01_00059988 predicted 1442
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122754 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309341 predicted 378
2 SASI_Mm02_00309342 predicted 1647
3 SASI_Mm02_00309343 predicted 1035
4 SASI_Mm02_00309344 predicted 1226
5 SASI_Mm02_00309345 predicted 1343
6 SASI_Mm02_00309346 predicted 1642
7 SASI_Mm02_00309347 predicted 826
8 SASI_Mm02_00309348 predicted 1393
9 SASI_Mm02_00309349 predicted 1611
10 SASI_Mm02_00309350 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013698 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00174651 predicted 374
2 SASI_Mm01_00174652 predicted 1635
3 SASI_Mm01_00174653 predicted 1023
4 SASI_Mm01_00174654 predicted 1219
5 SASI_Mm02_00322590 predicted 1343
6 SASI_Mm01_00174657 predicted 1638
7 SASI_Mm01_00174658 predicted 815
8 SASI_Mm01_00174659 predicted 1385
9 SASI_Mm01_00174660 predicted 1601
10 SASI_Mm02_00322591 predicted 702
11 SASI_Mm01_00174655 predicted 1653
12 SASI_Mm01_00174656 predicted 718
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013698
TXK MISSION shRNA Bacterial Glycerol Stock
TXK tyrosine kinase
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000361562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1264s21c1
Sequence:CCGGCAGTTCTGCCTGCGTAGTAAACTCGAGTTTACTACGCAGGCAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1589s21c1
Sequence:CCGGCCTAAAGGCCGTCCGACATTTCTCGAGAAATGTCGGACGGCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1039s21c1
Sequence:CCGGTTCGAGGTTAGTTCAACTTTACTCGAGTAAAGTTGAACTAACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-458s1c1
Sequence:CCGGGCCTGGTAATTTGGCACTGAACTCGAGTTCAGTGCCAAATTACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-541s1c1
Sequence:CCGGGCTTCGGGAATGAAGGCTTAACTCGAGTTAAGCCTTCATTCCCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-689s1c1
Sequence:CCGGCGTGAGAGATTCGAGACACTTCTCGAGAAGTGTCTCGAATCTCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-594s1c1
Sequence:CCGGGCCAACTTAGAAATCTATGAACTCGAGTTCATAGATTTCTAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000023603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-745s1c1
Sequence:CCGGGAAGGCATACACAGTCTTCAACTCGAGTTGAAGACTGTGTATGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013698
TXK MISSION shRNA shRNA Plasmid DNA
TXK tyrosine kinase
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000361562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1264s21c1
Sequence:CCGGCAGTTCTGCCTGCGTAGTAAACTCGAGTTTACTACGCAGGCAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1589s21c1
Sequence:CCGGCCTAAAGGCCGTCCGACATTTCTCGAGAAATGTCGGACGGCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1039s21c1
Sequence:CCGGTTCGAGGTTAGTTCAACTTTACTCGAGTAAAGTTGAACTAACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-458s1c1
Sequence:CCGGGCCTGGTAATTTGGCACTGAACTCGAGTTCAGTGCCAAATTACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-541s1c1
Sequence:CCGGGCTTCGGGAATGAAGGCTTAACTCGAGTTAAGCCTTCATTCCCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-689s1c1
Sequence:CCGGCGTGAGAGATTCGAGACACTTCTCGAGAAGTGTCTCGAATCTCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-594s1c1
Sequence:CCGGGCCAACTTAGAAATCTATGAACTCGAGTTCATAGATTTCTAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000023603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-745s1c1
Sequence:CCGGGAAGGCATACACAGTCTTCAACTCGAGTTGAAGACTGTGTATGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013698
TXK MISSION shRNA Lentiviral Transduction Particles
TXK tyrosine kinase
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000361562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1264s21c1
Sequence:CCGGCAGTTCTGCCTGCGTAGTAAACTCGAGTTTACTACGCAGGCAGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361492    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1589s21c1
Sequence:CCGGCCTAAAGGCCGTCCGACATTTCTCGAGAAATGTCGGACGGCCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361503    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013698.2-1039s21c1
Sequence:CCGGTTCGAGGTTAGTTCAACTTTACTCGAGTAAAGTTGAACTAACCTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023599    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-458s1c1
Sequence:CCGGGCCTGGTAATTTGGCACTGAACTCGAGTTCAGTGCCAAATTACCAGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-541s1c1
Sequence:CCGGGCTTCGGGAATGAAGGCTTAACTCGAGTTAAGCCTTCATTCCCGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023600    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-689s1c1
Sequence:CCGGCGTGAGAGATTCGAGACACTTCTCGAGAAGTGTCTCGAATCTCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023602    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-594s1c1
Sequence:CCGGGCCAACTTAGAAATCTATGAACTCGAGTTCATAGATTTCTAAGTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000023603    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013698.1-745s1c1
Sequence:CCGGGAAGGCATACACAGTCTTCAACTCGAGTTGAAGACTGTGTATGCCTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003328
VALIDATED
TXK MISSION shRNA Bacterial Glycerol Stock
TXK tyrosine kinase
Human
36 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003328.2-1280s21c1
Sequence:CCGGCAGTTCAACATGCATAGTAAACTCGAGTTTACTATGCATGTTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003328.2-1132s21c1
Sequence:CCGGGCTGCCTGCTTAACTATCTCACTCGAGTGAGATAGTTAAGCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-1684s21c1
Sequence:CCGGGCCAACCCAAAGAGTCATCTTCTCGAGAAGATGACTCTTTGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-2159s21c1
Sequence:CCGGGCACCTTTATAAATCACATGACTCGAGTCATGTGATTTATAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000314837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-1674s21c1
Sequence:CCGGGAAACAGAATGCCAACCCAAACTCGAGTTTGGGTTGGCATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1908s1c1
Sequence:CCGGCCCAAATGTGAAGAAGTGAAACTCGAGTTTCACTTCTTCACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1199s1c1
Sequence:CCGGCCAGGATATATGTGAAGGAATCTCGAGATTCCTTCACATATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1100s1c1
Sequence:CCGGCCTTTACATTGTGACAGAGTTCTCGAGAACTCTGTCACAATGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-368s1c1
Sequence:CCGGGCCCAGAGAACCCTGTAATTTCTCGAGAAATTACAGGGTTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1139s1c1
Sequence:CCGGGCTTAACTATCTCAGGGAGAACTCGAGTTCTCCCTGAGATAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-634s1c1
Sequence:CCGGCCTACACAATTTCCGTATTTACTCGAGTAAATACGGAAATTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003328.1-2110s1c1
Sequence:CCGGCCCTTGAAGAATTTCATGTTTCTCGAGAAACATGAAATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-585s1c1
Sequence:CCGGGAGTCTAAAGAAGGTGCATTTCTCGAGAAATGCACCTTCTTTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1557s1c1
Sequence:CCGGGCACCAATGTCCATATATGAACTCGAGTTCATATATGGACATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1641s1c1
Sequence:CCGGGCTGTCACAGAGATTGCGGAACTCGAGTTCCGCAATCTCTGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1684s1c1
Sequence:CCGGGCCAACCCAAAGAGTCATCTTCTCGAGAAGATGACTCTTTGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1565s1c1
Sequence:CCGGGTCCATATATGAAGTCATGTACTCGAGTACATGACTTCATATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-531s1c1
Sequence:CCGGGAGTGGTACCATAGAAACATTCTCGAGAATGTTTCTATGGTACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-245s1c1
Sequence:CCGGGTCAAATAAGAAGCAATCCAACTCGAGTTGGATTGCTTCTTATTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1590s1c1
Sequence:CCGGTGCTGGCATGAGAAACCTGAACTCGAGTTCAGGTTTCTCATGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000055429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-646s1c2
Sequence:CCGGCCGTATTTATGGGAGCTAGAACTCGAGTTCTAGCTCCCATAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-411s1c1
Sequence:CCGGTACCTGATACTGGAGAAATACCTCGAGGTATTTCTCCAGTATCAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-646s1c1
Sequence:CCGGCCGTATTTATGGGAGCTAGAACTCGAGTTCTAGCTCCCATAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-155s1c1
Sequence:CCGGGCGACAAATGAGAACACAGATCTCGAGATCTGTGTTCTCATTTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-1132s1c1
Sequence:CCGGGCTGCCTGCTTAACTATCTCACTCGAGTGAGATAGTTAAGCAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-408s1c1
Sequence:CCGGGAATACCTGATACTGGAGAAACTCGAGTTTCTCCAGTATCAGGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-1674s1c1
Sequence:CCGGGAAACAGAATGCCAACCCAAACTCGAGTTTGGGTTGGCATTCTGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-739s1c1
Sequence:CCGGGACACGCCTTTCAATCAATCCCTCGAGGGATTGATTGAAAGGCGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-1505s1c1
Sequence:CCGGGCAAGTCGTGGAAGCTATTTCCTCGAGGAAATAGCTTCCACGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-233s1c1
Sequence:CCGGGCTCAGCCAATTGTCAAATAACTCGAGTTATTTGACAATTGGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-330s1c1
Sequence:CCGGGAAGAGAAGATCCAAGTCAAGCTCGAGCTTGACTTGGATCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-759s1c1
Sequence:CCGGCCTGAGTTAATCTGGTATCACCTCGAGGTGATACCAGATTAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003328.1-2050s1c1
Sequence:CCGGCAGTGATCCATGCATAGAATACTCGAGTATTCTATGCATGGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1280s1c1
Sequence:CCGGCAGTTCAACATGCATAGTAAACTCGAGTTTACTATGCATGTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-1264s1c1
Sequence:CCGGCAAGGAATTGTTTGGTCAGTTCTCGAGAACTGACCAAACAATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-2159s1c1
Sequence:CCGGGCACCTTTATAAATCACATGACTCGAGTCATGTGATTTATAAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003328
VALIDATED
TXK MISSION shRNA shRNA Plasmid DNA
TXK tyrosine kinase
Human
36 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003328.2-1280s21c1
Sequence:CCGGCAGTTCAACATGCATAGTAAACTCGAGTTTACTATGCATGTTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003328.2-1132s21c1
Sequence:CCGGGCTGCCTGCTTAACTATCTCACTCGAGTGAGATAGTTAAGCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-1684s21c1
Sequence:CCGGGCCAACCCAAAGAGTCATCTTCTCGAGAAGATGACTCTTTGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-2159s21c1
Sequence:CCGGGCACCTTTATAAATCACATGACTCGAGTCATGTGATTTATAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000314837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-1674s21c1
Sequence:CCGGGAAACAGAATGCCAACCCAAACTCGAGTTTGGGTTGGCATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1908s1c1
Sequence:CCGGCCCAAATGTGAAGAAGTGAAACTCGAGTTTCACTTCTTCACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1199s1c1
Sequence:CCGGCCAGGATATATGTGAAGGAATCTCGAGATTCCTTCACATATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1100s1c1
Sequence:CCGGCCTTTACATTGTGACAGAGTTCTCGAGAACTCTGTCACAATGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-368s1c1
Sequence:CCGGGCCCAGAGAACCCTGTAATTTCTCGAGAAATTACAGGGTTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1139s1c1
Sequence:CCGGGCTTAACTATCTCAGGGAGAACTCGAGTTCTCCCTGAGATAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-634s1c1
Sequence:CCGGCCTACACAATTTCCGTATTTACTCGAGTAAATACGGAAATTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003328.1-2110s1c1
Sequence:CCGGCCCTTGAAGAATTTCATGTTTCTCGAGAAACATGAAATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-585s1c1
Sequence:CCGGGAGTCTAAAGAAGGTGCATTTCTCGAGAAATGCACCTTCTTTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1557s1c1
Sequence:CCGGGCACCAATGTCCATATATGAACTCGAGTTCATATATGGACATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1641s1c1
Sequence:CCGGGCTGTCACAGAGATTGCGGAACTCGAGTTCCGCAATCTCTGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1684s1c1
Sequence:CCGGGCCAACCCAAAGAGTCATCTTCTCGAGAAGATGACTCTTTGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1565s1c1
Sequence:CCGGGTCCATATATGAAGTCATGTACTCGAGTACATGACTTCATATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-531s1c1
Sequence:CCGGGAGTGGTACCATAGAAACATTCTCGAGAATGTTTCTATGGTACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-245s1c1
Sequence:CCGGGTCAAATAAGAAGCAATCCAACTCGAGTTGGATTGCTTCTTATTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1590s1c1
Sequence:CCGGTGCTGGCATGAGAAACCTGAACTCGAGTTCAGGTTTCTCATGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000055429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-646s1c2
Sequence:CCGGCCGTATTTATGGGAGCTAGAACTCGAGTTCTAGCTCCCATAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-411s1c1
Sequence:CCGGTACCTGATACTGGAGAAATACCTCGAGGTATTTCTCCAGTATCAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-646s1c1
Sequence:CCGGCCGTATTTATGGGAGCTAGAACTCGAGTTCTAGCTCCCATAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-155s1c1
Sequence:CCGGGCGACAAATGAGAACACAGATCTCGAGATCTGTGTTCTCATTTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-1132s1c1
Sequence:CCGGGCTGCCTGCTTAACTATCTCACTCGAGTGAGATAGTTAAGCAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-408s1c1
Sequence:CCGGGAATACCTGATACTGGAGAAACTCGAGTTTCTCCAGTATCAGGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-1674s1c1
Sequence:CCGGGAAACAGAATGCCAACCCAAACTCGAGTTTGGGTTGGCATTCTGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-739s1c1
Sequence:CCGGGACACGCCTTTCAATCAATCCCTCGAGGGATTGATTGAAAGGCGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-1505s1c1
Sequence:CCGGGCAAGTCGTGGAAGCTATTTCCTCGAGGAAATAGCTTCCACGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-233s1c1
Sequence:CCGGGCTCAGCCAATTGTCAAATAACTCGAGTTATTTGACAATTGGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-330s1c1
Sequence:CCGGGAAGAGAAGATCCAAGTCAAGCTCGAGCTTGACTTGGATCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-759s1c1
Sequence:CCGGCCTGAGTTAATCTGGTATCACCTCGAGGTGATACCAGATTAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003328.1-2050s1c1
Sequence:CCGGCAGTGATCCATGCATAGAATACTCGAGTATTCTATGCATGGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1280s1c1
Sequence:CCGGCAGTTCAACATGCATAGTAAACTCGAGTTTACTATGCATGTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-1264s1c1
Sequence:CCGGCAAGGAATTGTTTGGTCAGTTCTCGAGAACTGACCAAACAATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-2159s1c1
Sequence:CCGGGCACCTTTATAAATCACATGACTCGAGTCATGTGATTTATAAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003328
VALIDATED
TXK MISSION shRNA Lentiviral Transduction Particles
TXK tyrosine kinase
Human
36 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314836    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003328.2-1280s21c1
Sequence:CCGGCAGTTCAACATGCATAGTAAACTCGAGTTTACTATGCATGTTGAACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314783    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003328.2-1132s21c1
Sequence:CCGGGCTGCCTGCTTAACTATCTCACTCGAGTGAGATAGTTAAGCAGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314784    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-1684s21c1
Sequence:CCGGGCCAACCCAAAGAGTCATCTTCTCGAGAAGATGACTCTTTGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314838    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-2159s21c1
Sequence:CCGGGCACCTTTATAAATCACATGACTCGAGTCATGTGATTTATAAAGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000314837    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_003328.2-1674s21c1
Sequence:CCGGGAAACAGAATGCCAACCCAAACTCGAGTTTGGGTTGGCATTCTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121287    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1908s1c1
Sequence:CCGGCCCAAATGTGAAGAAGTGAAACTCGAGTTTCACTTCTTCACATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121178    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1199s1c1
Sequence:CCGGCCAGGATATATGTGAAGGAATCTCGAGATTCCTTCACATATATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121111    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1100s1c1
Sequence:CCGGCCTTTACATTGTGACAGAGTTCTCGAGAACTCTGTCACAATGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-368s1c1
Sequence:CCGGGCCCAGAGAACCCTGTAATTTCTCGAGAAATTACAGGGTTCTCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1139s1c1
Sequence:CCGGGCTTAACTATCTCAGGGAGAACTCGAGTTCTCCCTGAGATAGTTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-634s1c1
Sequence:CCGGCCTACACAATTTCCGTATTTACTCGAGTAAATACGGAAATTGTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121107    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003328.1-2110s1c1
Sequence:CCGGCCCTTGAAGAATTTCATGTTTCTCGAGAAACATGAAATTCTTCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121181    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-585s1c1
Sequence:CCGGGAGTCTAAAGAAGGTGCATTTCTCGAGAAATGCACCTTCTTTAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121180    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1557s1c1
Sequence:CCGGGCACCAATGTCCATATATGAACTCGAGTTCATATATGGACATTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121179    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1641s1c1
Sequence:CCGGGCTGTCACAGAGATTGCGGAACTCGAGTTCCGCAATCTCTGTGACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121177    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1684s1c1
Sequence:CCGGGCCAACCCAAAGAGTCATCTTCTCGAGAAGATGACTCTTTGGGTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121288    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1565s1c1
Sequence:CCGGGTCCATATATGAAGTCATGTACTCGAGTACATGACTTCATATATGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121289    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-531s1c1
Sequence:CCGGGAGTGGTACCATAGAAACATTCTCGAGAATGTTTCTATGGTACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121290    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-245s1c1
Sequence:CCGGGTCAAATAAGAAGCAATCCAACTCGAGTTGGATTGCTTCTTATTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121291    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-1590s1c1
Sequence:CCGGTGCTGGCATGAGAAACCTGAACTCGAGTTCAGGTTTCTCATGCCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000055429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-646s1c2
Sequence:CCGGCCGTATTTATGGGAGCTAGAACTCGAGTTCTAGCTCCCATAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-411s1c1
Sequence:CCGGTACCTGATACTGGAGAAATACCTCGAGGTATTTCTCCAGTATCAGGTATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009998    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-646s1c1
Sequence:CCGGCCGTATTTATGGGAGCTAGAACTCGAGTTCTAGCTCCCATAAATACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001578    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-155s1c1
Sequence:CCGGGCGACAAATGAGAACACAGATCTCGAGATCTGTGTTCTCATTTGTCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-1132s1c1
Sequence:CCGGGCTGCCTGCTTAACTATCTCACTCGAGTGAGATAGTTAAGCAGGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.x-408s1c1
Sequence:CCGGGAATACCTGATACTGGAGAAACTCGAGTTTCTCCAGTATCAGGTATTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001577    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-1674s1c1
Sequence:CCGGGAAACAGAATGCCAACCCAAACTCGAGTTTGGGTTGGCATTCTGTTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009999    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.x-739s1c1
Sequence:CCGGGACACGCCTTTCAATCAATCCCTCGAGGGATTGATTGAAAGGCGTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196957    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-1505s1c1
Sequence:CCGGGCAAGTCGTGGAAGCTATTTCCTCGAGGAAATAGCTTCCACGACTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196460    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-233s1c1
Sequence:CCGGGCTCAGCCAATTGTCAAATAACTCGAGTTATTTGACAATTGGCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196461    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-330s1c1
Sequence:CCGGGAAGAGAAGATCCAAGTCAAGCTCGAGCTTGACTTGGATCTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194674    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003328.1-759s1c1
Sequence:CCGGCCTGAGTTAATCTGGTATCACCTCGAGGTGATACCAGATTAACTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194951    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_003328.1-2050s1c1
Sequence:CCGGCAGTGATCCATGCATAGAATACTCGAGTATTCTATGCATGGATCACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194938    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-1280s1c1
Sequence:CCGGCAGTTCAACATGCATAGTAAACTCGAGTTTACTATGCATGTTGAACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195084    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_003328.1-1264s1c1
Sequence:CCGGCAAGGAATTGTTTGGTCAGTTCTCGAGAACTGACCAAACAATTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196365    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_003328.1-2159s1c1
Sequence:CCGGGCACCTTTATAAATCACATGACTCGAGTCATGTGATTTATAAAGGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks