EMAIL THIS PAGE TO A FRIEND

TXLNA

taxilin alpha

Synonyms: IL14 RP4-622L5.4 TXLN
Gene ID:
Mouse(109658) taxilin alpha
Rat(682457) taxilin alpha
cow(511331) taxilin alpha
sheep(101116887) taxilin alpha
Zebrafish(324180) taxilin alpha
domestic cat(101080724) taxilin alpha
Horse(100056006) taxilin alpha
dog(487313) taxilin alpha
chicken(419648) taxilin alpha
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005506 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001005506 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001005506 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_175852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_175852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_175852 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_175852 Rosetta Predictions human pricing
NM_001127633 Rosetta Predictions rat pricing
NM_001005506 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00091065 predicted 1293
2 SASI_Hs01_00091066 predicted 388
3 SASI_Hs01_00091067 predicted 297
4 SASI_Hs01_00091068 predicted 1234
5 SASI_Hs01_00091069 predicted 1208
6 SASI_Hs01_00091070 predicted 404
7 SASI_Hs01_00091071 predicted 591
8 SASI_Hs01_00091072 predicted 430
9 SASI_Hs01_00091073 predicted 1157
10 SASI_Hs01_00091074 predicted 1806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127633 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254670 predicted 367
2 SASI_Rn02_00254671 predicted 1276
3 SASI_Rn02_00254672 predicted 438
4 SASI_Rn02_00254673 predicted 349
5 SASI_Rn02_00254674 predicted 1331
6 SASI_Rn02_00254675 predicted 926
7 SASI_Rn02_00254676 predicted 1869
8 SASI_Rn02_00254677 predicted 1347
9 SASI_Rn02_00254678 predicted 575
10 SASI_Rn02_00254679 predicted 1082
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00021193 predicted 1282
2 SASI_Mm01_00021194 predicted 1425
3 SASI_Mm01_00021195 predicted 1018
4 SASI_Mm01_00021196 predicted 2182
5 SASI_Mm02_00286603 predicted 1067
6 SASI_Mm01_00021197 predicted 1977
7 SASI_Mm01_00021198 predicted 1505
8 SASI_Mm01_00021199 predicted 1491
9 SASI_Mm01_00021200 predicted 1695
10 SASI_Mm02_00286604 predicted 2137
11 SASI_Mm01_00021192 predicted 467
12 SASI_Mm01_00021201 predicted 1192
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005506
VALIDATED
TXLNA MISSION shRNA Bacterial Glycerol Stock
taxilin alpha
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000196043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005506.1-790s1c1
Sequence:CCGGGCACTGTGCAAGAAGTATGCTCTCGAGAGCATACTTCTTGCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005506.1-3391s1c1
Sequence:CCGGGCCAAGGTGTTGAGTCAGTTTCTCGAGAAACTGACTCAACACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005506.1-1188s1c1
Sequence:CCGGCGACAAAGTCTTCAAACATAACTCGAGTTATGTTTGAAGACTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005506.2-544s21c1
Sequence:CCGGACGGAGAAGTCCCGAACCTATCTCGAGATAGGTTCGGGACTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005506.2-470s21c1
Sequence:CCGGCATACTGTGTGGACAACAATCCTCGAGGATTGTTGTCCACACAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005506.2-3515s21c1
Sequence:CCGGTACTTGCTACCCTGGTATATTCTCGAGAATATACCAGGGTAGCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005506.2-1146s21c1
Sequence:CCGGCAAGAAGTTGATCGAGCAATACTCGAGTATTGCTCGATCAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005506
VALIDATED
TXLNA MISSION shRNA shRNA Plasmid DNA
taxilin alpha
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000196043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005506.1-790s1c1
Sequence:CCGGGCACTGTGCAAGAAGTATGCTCTCGAGAGCATACTTCTTGCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005506.1-3391s1c1
Sequence:CCGGGCCAAGGTGTTGAGTCAGTTTCTCGAGAAACTGACTCAACACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005506.1-1188s1c1
Sequence:CCGGCGACAAAGTCTTCAAACATAACTCGAGTTATGTTTGAAGACTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005506.2-544s21c1
Sequence:CCGGACGGAGAAGTCCCGAACCTATCTCGAGATAGGTTCGGGACTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005506.2-470s21c1
Sequence:CCGGCATACTGTGTGGACAACAATCCTCGAGGATTGTTGTCCACACAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005506.2-3515s21c1
Sequence:CCGGTACTTGCTACCCTGGTATATTCTCGAGAATATACCAGGGTAGCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005506.2-1146s21c1
Sequence:CCGGCAAGAAGTTGATCGAGCAATACTCGAGTATTGCTCGATCAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005506
VALIDATED
TXLNA MISSION shRNA Lentiviral Transduction Particles
taxilin alpha
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000196043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005506.1-790s1c1
Sequence:CCGGGCACTGTGCAAGAAGTATGCTCTCGAGAGCATACTTCTTGCACAGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184612    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001005506.1-3391s1c1
Sequence:CCGGGCCAAGGTGTTGAGTCAGTTTCTCGAGAAACTGACTCAACACCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183738    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001005506.1-1188s1c1
Sequence:CCGGCGACAAAGTCTTCAAACATAACTCGAGTTATGTTTGAAGACTTTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005506.2-544s21c1
Sequence:CCGGACGGAGAAGTCCCGAACCTATCTCGAGATAGGTTCGGGACTTCTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251158    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_001005506.2-470s21c1
Sequence:CCGGCATACTGTGTGGACAACAATCCTCGAGGATTGTTGTCCACACAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251157    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005506.2-3515s21c1
Sequence:CCGGTACTTGCTACCCTGGTATATTCTCGAGAATATACCAGGGTAGCAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005506.2-1146s21c1
Sequence:CCGGCAAGAAGTTGATCGAGCAATACTCGAGTATTGCTCGATCAACTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175852
VALIDATED
TXLNA MISSION shRNA Bacterial Glycerol Stock
taxilin alpha
Human
16 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000130767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-1223s1c1
Sequence:CCGGGCTTGCCCTATACACAGAGAACTCGAGTTCTCTGTGTATAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-1022s1c1
Sequence:CCGGCGAGGAGCATATCGACAAAGTCTCGAGACTTTGTCGATATGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-689s1c1
Sequence:CCGGGCAGATGAAGCTCCTACAGAACTCGAGTTCTGTAGGAGCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-2637s1c1
Sequence:CCGGGCCATCTTGATGCTGAGGTTTCTCGAGAAACCTCAGCATCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-3433s1c1
Sequence:CCGGGCATCAGAGTTGCCTGCTATTCTCGAGAATAGCAGGCAACTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000127920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-896s1c1
Sequence:CCGGCCAGGTGACACTGAATGACATCTCGAGATGTCATTCAGTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-1235s1c1
Sequence:CCGGCACAGAGAAGTTTGAGGAGTTCTCGAGAACTCCTCAAACTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-897s1c1
Sequence:CCGGCAGGTGACACTGAATGACATTCTCGAGAATGTCATTCAGTGTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-316s21c1
Sequence:GTACCGGGCACATACTGTGTGGACAATACTCGAGTATTGTCCACACAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-95s21c1
Sequence:GTACCGGTGCCAAACAATCCAATCCAAACTCGAGTTTGGATTGGATTGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-586s21c1
Sequence:CCGGTGCTGATGCAGACATTGAATACTCGAGTATTCAATGTCTGCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175852.3-3433s21c1
Sequence:CCGGGCATCAGAGTTGCCTGCTATTCTCGAGAATAGCAGGCAACTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1235s21c1
Sequence:CCGGCACAGAGAAGTTTGAGGAGTTCTCGAGAACTCCTCAAACTTCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1022s21c1
Sequence:CCGGCGAGGAGCATATCGACAAAGTCTCGAGACTTTGTCGATATGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000281218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175852.3-2637s21c1
Sequence:CCGGGCCATCTTGATGCTGAGGTTTCTCGAGAAACCTCAGCATCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000380643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1278s21c1
Sequence:GTACCGGAGCGAGGTATTCACCACATTCCTCGAGGAATGTGGTGAATACCTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175852
VALIDATED
TXLNA MISSION shRNA shRNA Plasmid DNA
taxilin alpha
Human
16 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000130767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-1223s1c1
Sequence:CCGGGCTTGCCCTATACACAGAGAACTCGAGTTCTCTGTGTATAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-1022s1c1
Sequence:CCGGCGAGGAGCATATCGACAAAGTCTCGAGACTTTGTCGATATGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-689s1c1
Sequence:CCGGGCAGATGAAGCTCCTACAGAACTCGAGTTCTGTAGGAGCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-2637s1c1
Sequence:CCGGGCCATCTTGATGCTGAGGTTTCTCGAGAAACCTCAGCATCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-3433s1c1
Sequence:CCGGGCATCAGAGTTGCCTGCTATTCTCGAGAATAGCAGGCAACTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000127920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-896s1c1
Sequence:CCGGCCAGGTGACACTGAATGACATCTCGAGATGTCATTCAGTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-1235s1c1
Sequence:CCGGCACAGAGAAGTTTGAGGAGTTCTCGAGAACTCCTCAAACTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-897s1c1
Sequence:CCGGCAGGTGACACTGAATGACATTCTCGAGAATGTCATTCAGTGTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-316s21c1
Sequence:GTACCGGGCACATACTGTGTGGACAATACTCGAGTATTGTCCACACAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-95s21c1
Sequence:GTACCGGTGCCAAACAATCCAATCCAAACTCGAGTTTGGATTGGATTGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-586s21c1
Sequence:CCGGTGCTGATGCAGACATTGAATACTCGAGTATTCAATGTCTGCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175852.3-3433s21c1
Sequence:CCGGGCATCAGAGTTGCCTGCTATTCTCGAGAATAGCAGGCAACTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1235s21c1
Sequence:CCGGCACAGAGAAGTTTGAGGAGTTCTCGAGAACTCCTCAAACTTCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1022s21c1
Sequence:CCGGCGAGGAGCATATCGACAAAGTCTCGAGACTTTGTCGATATGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000281218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175852.3-2637s21c1
Sequence:CCGGGCCATCTTGATGCTGAGGTTTCTCGAGAAACCTCAGCATCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000380643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1278s21c1
Sequence:GTACCGGAGCGAGGTATTCACCACATTCCTCGAGGAATGTGGTGAATACCTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175852
VALIDATED
TXLNA MISSION shRNA Lentiviral Transduction Particles
taxilin alpha
Human
16 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000130767    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-1223s1c1
Sequence:CCGGGCTTGCCCTATACACAGAGAACTCGAGTTCTCTGTGTATAGGGCAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128087    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-1022s1c1
Sequence:CCGGCGAGGAGCATATCGACAAAGTCTCGAGACTTTGTCGATATGCTCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127855    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-689s1c1
Sequence:CCGGGCAGATGAAGCTCCTACAGAACTCGAGTTCTGTAGGAGCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127706    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-2637s1c1
Sequence:CCGGGCCATCTTGATGCTGAGGTTTCTCGAGAAACCTCAGCATCAAGATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127769    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-3433s1c1
Sequence:CCGGGCATCAGAGTTGCCTGCTATTCTCGAGAATAGCAGGCAACTCTGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000127920    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175852.3-896s1c1
Sequence:CCGGCCAGGTGACACTGAATGACATCTCGAGATGTCATTCAGTGTCACCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-1235s1c1
Sequence:CCGGCACAGAGAAGTTTGAGGAGTTCTCGAGAACTCCTCAAACTTCTCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_175852.3-897s1c1
Sequence:CCGGCAGGTGACACTGAATGACATTCTCGAGAATGTCATTCAGTGTCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-316s21c1
Sequence:GTACCGGGCACATACTGTGTGGACAATACTCGAGTATTGTCCACACAGTATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380386    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-95s21c1
Sequence:GTACCGGTGCCAAACAATCCAATCCAAACTCGAGTTTGGATTGGATTGTTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281220    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-586s21c1
Sequence:CCGGTGCTGATGCAGACATTGAATACTCGAGTATTCAATGTCTGCATCAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175852.3-3433s21c1
Sequence:CCGGGCATCAGAGTTGCCTGCTATTCTCGAGAATAGCAGGCAACTCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1235s21c1
Sequence:CCGGCACAGAGAAGTTTGAGGAGTTCTCGAGAACTCCTCAAACTTCTCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1022s21c1
Sequence:CCGGCGAGGAGCATATCGACAAAGTCTCGAGACTTTGTCGATATGCTCCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000281218    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175852.3-2637s21c1
Sequence:CCGGGCCATCTTGATGCTGAGGTTTCTCGAGAAACCTCAGCATCAAGATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000380643    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175852.3-1278s21c1
Sequence:GTACCGGAGCGAGGTATTCACCACATTCCTCGAGGAATGTGGTGAATACCTCGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks