EMAIL THIS PAGE TO A FRIEND

TXLNB

taxilin beta

Synonyms: C6orf198 LST001 MDP77 dJ522B19.2
UniProtKB ID: Q8N3L3, Q5VTF3, Q76L25, Q86T52, Q8N3S2
Gene ID:
Mouse(378431) taxilin beta
Rat(308622) taxilin beta
chicken(395515) taxilin beta
dog(476224) taxilin beta
cow(518778) taxilin beta
sheep(101115628) taxilin beta
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153235 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_153235 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_153235 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_138628 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_138628 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_138628 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU059541 MISSION® esiRNA esiRNA human TXLNB (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_153235 Rosetta Predictions human pricing
XM_001072039 Rosetta Predictions rat pricing
XM_218658 Rosetta Predictions rat pricing
NM_138628 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153235 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00367101 predicted 534
2 SASI_Hs01_00199924 predicted 1679
3 SASI_Hs01_00199925 predicted 698
4 SASI_Hs01_00199926 predicted 725
5 SASI_Hs01_00199927 predicted 1458
6 SASI_Hs01_00199928 predicted 1323
7 SASI_Hs01_00199929 predicted 1627
8 SASI_Hs01_00199930 predicted 1746
9 SASI_Hs01_00199931 predicted 1326
10 SASI_Hs01_00199932 predicted 655
11 SASI_Hs01_00199933 predicted 1377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072039 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00337534 predicted 1229
2 SASI_Rn02_00337535 predicted 372
3 SASI_Rn02_00337536 predicted 2035
4 SASI_Rn02_00337537 predicted 1212
5 SASI_Rn02_00337538 predicted 589
6 SASI_Rn02_00337539 predicted 440
7 SASI_Rn02_00337540 predicted 2092
8 SASI_Rn02_00337541 predicted 1135
9 SASI_Rn02_00337542 predicted 307
10 SASI_Rn02_00337543 predicted 1935
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_218658 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00377953 predicted 846
2 SASI_Rn02_00377954 predicted 1651
3 SASI_Rn02_00377955 predicted 834
4 SASI_Rn02_00377956 predicted 211
5 SASI_Rn02_00377957 predicted 1191
6 SASI_Rn02_00377958 predicted 1719
7 SASI_Rn02_00377959 predicted 1683
8 SASI_Rn02_00377960 predicted 763
9 SASI_Rn02_00377961 predicted 1558
10 SASI_Rn02_00377962 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_138628 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00029720 predicted 1352
2 SASI_Mm01_00029721 predicted 2333
3 SASI_Mm01_00029722 predicted 1382
4 SASI_Mm01_00029723 predicted 1437
5 SASI_Mm02_00339684 predicted 963
6 SASI_Mm01_00029724 predicted 541
7 SASI_Mm01_00029725 predicted 2315
8 SASI_Mm02_00339685 predicted 515
9 SASI_Mm01_00029726 predicted 1358
10 SASI_Mm01_00029727 predicted 487
11 SASI_Mm01_00029728 predicted 2187
12 SASI_Mm01_00029729 predicted 884
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153235
TXLNB MISSION shRNA Bacterial Glycerol Stock
taxilin beta
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000440863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153235.3-951s21c1
Sequence:CCGGGCAGCAGAGTGAGCGAAATATCTCGAGATATTTCGCTCACTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153235.3-2630s21c1
Sequence:CCGGATGGATGCCCAGGTTACATTTCTCGAGAAATGTAACCTGGGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1672s1c1
Sequence:CCGGCCAAAGAAACCCAACCCGAAACTCGAGTTTCGGGTTGGGTTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-621s1c1
Sequence:CCGGGCTGAATTGCTGGATGAACATCTCGAGATGTTCATCCAGCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1226s1c1
Sequence:CCGGGAGCACACTAACTAAAGGCAACTCGAGTTGCCTTTAGTTAGTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-383s1c1
Sequence:CCGGGAATGCAGAATCACCTGACAACTCGAGTTGTCAGGTGATTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000166966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153235.2-3908s1c1
Sequence:CCGGGCATACAGTTTGTTTGAAGTACTCGAGTACTTCAAACAAACTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1392s1c1
Sequence:CCGGGCTAAAGAATATGAGTGCTTTCTCGAGAAAGCACTCATATTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1629s1c1
Sequence:CCGGGCCTTCATGATAATTCATCATCTCGAGATGATGAATTATCATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153235
TXLNB MISSION shRNA shRNA Plasmid DNA
taxilin beta
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000440863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153235.3-951s21c1
Sequence:CCGGGCAGCAGAGTGAGCGAAATATCTCGAGATATTTCGCTCACTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153235.3-2630s21c1
Sequence:CCGGATGGATGCCCAGGTTACATTTCTCGAGAAATGTAACCTGGGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1672s1c1
Sequence:CCGGCCAAAGAAACCCAACCCGAAACTCGAGTTTCGGGTTGGGTTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-621s1c1
Sequence:CCGGGCTGAATTGCTGGATGAACATCTCGAGATGTTCATCCAGCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1226s1c1
Sequence:CCGGGAGCACACTAACTAAAGGCAACTCGAGTTGCCTTTAGTTAGTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-383s1c1
Sequence:CCGGGAATGCAGAATCACCTGACAACTCGAGTTGTCAGGTGATTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000166966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153235.2-3908s1c1
Sequence:CCGGGCATACAGTTTGTTTGAAGTACTCGAGTACTTCAAACAAACTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1392s1c1
Sequence:CCGGGCTAAAGAATATGAGTGCTTTCTCGAGAAAGCACTCATATTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1629s1c1
Sequence:CCGGGCCTTCATGATAATTCATCATCTCGAGATGATGAATTATCATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153235
TXLNB MISSION shRNA Lentiviral Transduction Particles
taxilin beta
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000440863    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153235.3-951s21c1
Sequence:CCGGGCAGCAGAGTGAGCGAAATATCTCGAGATATTTCGCTCACTCTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415054    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_153235.3-2630s21c1
Sequence:CCGGATGGATGCCCAGGTTACATTTCTCGAGAAATGTAACCTGGGCATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172996    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1672s1c1
Sequence:CCGGCCAAAGAAACCCAACCCGAAACTCGAGTTTCGGGTTGGGTTTCTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168721    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-621s1c1
Sequence:CCGGGCTGAATTGCTGGATGAACATCTCGAGATGTTCATCCAGCAATTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168804    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1226s1c1
Sequence:CCGGGAGCACACTAACTAAAGGCAACTCGAGTTGCCTTTAGTTAGTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168432    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-383s1c1
Sequence:CCGGGAATGCAGAATCACCTGACAACTCGAGTTGTCAGGTGATTCTGCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000166966    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_153235.2-3908s1c1
Sequence:CCGGGCATACAGTTTGTTTGAAGTACTCGAGTACTTCAAACAAACTGTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167865    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1392s1c1
Sequence:CCGGGCTAAAGAATATGAGTGCTTTCTCGAGAAAGCACTCATATTCTTTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167832    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_153235.2-1629s1c1
Sequence:CCGGGCCTTCATGATAATTCATCATCTCGAGATGATGAATTATCATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_138628
VALIDATED
TXLNB MISSION shRNA Bacterial Glycerol Stock
taxilin beta
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000248110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1504s21c1
Sequence:CCGGGCTAAAGAATACGAGTGTTTCCTCGAGGAAACACTCGTATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138628.3-3590s21c1
Sequence:CCGGACGGTCTAATCTAACTCTATGCTCGAGCATAGAGTTAGATTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138628.3-408s21c1
Sequence:CCGGGCAACTGGAAGACATCATAAGCTCGAGCTTATGATGTCTTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1546s21c1
Sequence:CCGGGAGAACCTGTGTCGTGCTTTACTCGAGTAAAGCACGACACAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1011s21c1
Sequence:CCGGACAACAGAGTGAGCGCAATATCTCGAGATATTGCGCTCACTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138628.1-355s1c1
Sequence:CCGGGAAGACATCATAAGCACGTATCTCGAGATACGTGCTTATGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138628.1-1973s1c1
Sequence:CCGGCCCATAAACCAGAGGCAAACACTCGAGTGTTTGCCTCTGGTTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_138628
VALIDATED
TXLNB MISSION shRNA shRNA Plasmid DNA
taxilin beta
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000248110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1504s21c1
Sequence:CCGGGCTAAAGAATACGAGTGTTTCCTCGAGGAAACACTCGTATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138628.3-3590s21c1
Sequence:CCGGACGGTCTAATCTAACTCTATGCTCGAGCATAGAGTTAGATTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138628.3-408s21c1
Sequence:CCGGGCAACTGGAAGACATCATAAGCTCGAGCTTATGATGTCTTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1546s21c1
Sequence:CCGGGAGAACCTGTGTCGTGCTTTACTCGAGTAAAGCACGACACAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1011s21c1
Sequence:CCGGACAACAGAGTGAGCGCAATATCTCGAGATATTGCGCTCACTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138628.1-355s1c1
Sequence:CCGGGAAGACATCATAAGCACGTATCTCGAGATACGTGCTTATGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138628.1-1973s1c1
Sequence:CCGGCCCATAAACCAGAGGCAAACACTCGAGTGTTTGCCTCTGGTTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_138628
VALIDATED
TXLNB MISSION shRNA Lentiviral Transduction Particles
taxilin beta
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000248110    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1504s21c1
Sequence:CCGGGCTAAAGAATACGAGTGTTTCCTCGAGGAAACACTCGTATTCTTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248109    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_138628.3-3590s21c1
Sequence:CCGGACGGTCTAATCTAACTCTATGCTCGAGCATAGAGTTAGATTAGACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248108    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_138628.3-408s21c1
Sequence:CCGGGCAACTGGAAGACATCATAAGCTCGAGCTTATGATGTCTTCCAGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248107    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1546s21c1
Sequence:CCGGGAGAACCTGTGTCGTGCTTTACTCGAGTAAAGCACGACACAGGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248106    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_138628.3-1011s21c1
Sequence:CCGGACAACAGAGTGAGCGCAATATCTCGAGATATTGCGCTCACTCTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183156    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138628.1-355s1c1
Sequence:CCGGGAAGACATCATAAGCACGTATCTCGAGATACGTGCTTATGATGTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195995    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_138628.1-1973s1c1
Sequence:CCGGCCCATAAACCAGAGGCAAACACTCGAGTGTTTGCCTCTGGTTTATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks