EMAIL THIS PAGE TO A FRIEND

TXLNG2P

taxilin gamma 2, pseudogene

Synonyms: CYorf15A CYorf15B
Species: Human TXLNG2P(246126)
UniProtKB ID: Q9BZA5
Gene ID:
26 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302904 ANTI-CYORF15A (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001005852 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001005852 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001005852 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120161 MISSION® esiRNA esiRNA human CYorf15A (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001005852 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005852 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305030 predicted 243
2 SASI_Hs02_00305031 predicted 378
3 SASI_Hs01_00244980 predicted 229
4 SASI_Hs02_00305032 predicted 319
5 SASI_Hs02_00305033 predicted 343
6 SASI_Hs01_00244981 predicted 199
7 SASI_Hs02_00305034 predicted 383
8 SASI_Hs02_00305035 predicted 300
9 SASI_Hs02_00305036 predicted 222
10 SASI_Hs02_00305037 predicted 278
11 SASI_Hs01_00244974 predicted 269
12 SASI_Hs01_00244975 predicted 971
13 SASI_Hs01_00244976 predicted 282
14 SASI_Hs01_00244977 predicted 1093
15 SASI_Hs01_00244978 predicted 1031
16 SASI_Hs01_00244979 predicted 938
17 SASI_Hs01_00244982 predicted 1060
18 SASI_Hs01_00244983 predicted 1032
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001005852
VALIDATED
TXLNG2P MISSION shRNA Bacterial Glycerol Stock
taxilin gamma 2, pseudogene
Human
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000447111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005852.2-617s21c1
Sequence:CCGAGGGAAACCCTACTAGACTTTGCTCGAGCAAAGTCTAGTAGGGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-381s21c1
Sequence:CCGGCCGTCTGGTCAGCAAGCTTTACTCGAGTAAAGCTTGCTGACCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005852.2-596s21c1
Sequence:CCGGACTATGGAAACATTCTCAACACTCGAGTGTTGAGAATGTTTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-249s21c1
Sequence:CCGGGCCACAAGTAATAAACATTTACTCGAGTAAATGTTTATTACTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-447s21c1
Sequence:CCGGTTATTGATGCAAGCCCTAAACCTCGAGGTTTAGGGCTTGCATCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-519s21c1
Sequence:CCGGGATCTTGGAAATTCACCTCTTCTCGAGAAGAGGTGAATTTCCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-441s1c1
Sequence:CCGGGAGCTTCCTGAGCAAGAAGTACTCGAGTACTTCTTGCTCAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-321s1c1
Sequence:CCGGGACTCAAATTGCAGTGCCACACTCGAGTGTGGCACTGCAATTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-363s1c1
Sequence:CCGGGATGAAGAAGGCCGTGACTTTCTCGAGAAAGTCACGGCCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-265s1c1
Sequence:CCGGGAGAGAAAGCAGATATGTTGTCTCGAGACAACATATCTGCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-273s1c1
Sequence:CCGGGCAGATATGTTGTGTAACTCTCTCGAGAGAGTTACACAACATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-1733s1c1
Sequence:CCGGGCAGCTCTCTGTAAGAAATATCTCGAGATATTTCTTACAGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-373s1c1
Sequence:CCGGGCCGTGACTTTATAACAAAGACTCGAGTCTTTGTTATAAAGTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-611s1c1
Sequence:CCGGGTCTCTTCAGACTCTAGAGTACTCGAGTACTCTAGAGTCTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005852.1-1183s1c1
Sequence:CCGGCCCAGAATATGCTTAGCAGATCTCGAGATCTGCTAAGCATATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001005852
VALIDATED
TXLNG2P MISSION shRNA shRNA Plasmid DNA
taxilin gamma 2, pseudogene
Human
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000447111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005852.2-617s21c1
Sequence:CCGAGGGAAACCCTACTAGACTTTGCTCGAGCAAAGTCTAGTAGGGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-381s21c1
Sequence:CCGGCCGTCTGGTCAGCAAGCTTTACTCGAGTAAAGCTTGCTGACCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005852.2-596s21c1
Sequence:CCGGACTATGGAAACATTCTCAACACTCGAGTGTTGAGAATGTTTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-249s21c1
Sequence:CCGGGCCACAAGTAATAAACATTTACTCGAGTAAATGTTTATTACTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-447s21c1
Sequence:CCGGTTATTGATGCAAGCCCTAAACCTCGAGGTTTAGGGCTTGCATCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-519s21c1
Sequence:CCGGGATCTTGGAAATTCACCTCTTCTCGAGAAGAGGTGAATTTCCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-441s1c1
Sequence:CCGGGAGCTTCCTGAGCAAGAAGTACTCGAGTACTTCTTGCTCAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-321s1c1
Sequence:CCGGGACTCAAATTGCAGTGCCACACTCGAGTGTGGCACTGCAATTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-363s1c1
Sequence:CCGGGATGAAGAAGGCCGTGACTTTCTCGAGAAAGTCACGGCCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-265s1c1
Sequence:CCGGGAGAGAAAGCAGATATGTTGTCTCGAGACAACATATCTGCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-273s1c1
Sequence:CCGGGCAGATATGTTGTGTAACTCTCTCGAGAGAGTTACACAACATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-1733s1c1
Sequence:CCGGGCAGCTCTCTGTAAGAAATATCTCGAGATATTTCTTACAGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-373s1c1
Sequence:CCGGGCCGTGACTTTATAACAAAGACTCGAGTCTTTGTTATAAAGTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-611s1c1
Sequence:CCGGGTCTCTTCAGACTCTAGAGTACTCGAGTACTCTAGAGTCTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005852.1-1183s1c1
Sequence:CCGGCCCAGAATATGCTTAGCAGATCTCGAGATCTGCTAAGCATATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001005852
VALIDATED
TXLNG2P MISSION shRNA Lentiviral Transduction Particles
taxilin gamma 2, pseudogene
Human
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000447111    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005852.2-617s21c1
Sequence:CCGAGGGAAACCCTACTAGACTTTGCTCGAGCAAAGTCTAGTAGGGTTTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-381s21c1
Sequence:CCGGCCGTCTGGTCAGCAAGCTTTACTCGAGTAAAGCTTGCTGACCAGACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427250    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001005852.2-596s21c1
Sequence:CCGGACTATGGAAACATTCTCAACACTCGAGTGTTGAGAATGTTTCCATAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-249s21c1
Sequence:CCGGGCCACAAGTAATAAACATTTACTCGAGTAAATGTTTATTACTTGTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421178    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-447s21c1
Sequence:CCGGTTATTGATGCAAGCCCTAAACCTCGAGGTTTAGGGCTTGCATCAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426444    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001005852.2-519s21c1
Sequence:CCGGGATCTTGGAAATTCACCTCTTCTCGAGAAGAGGTGAATTTCCAAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-441s1c1
Sequence:CCGGGAGCTTCCTGAGCAAGAAGTACTCGAGTACTTCTTGCTCAGGAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-321s1c1
Sequence:CCGGGACTCAAATTGCAGTGCCACACTCGAGTGTGGCACTGCAATTTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130770    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-363s1c1
Sequence:CCGGGATGAAGAAGGCCGTGACTTTCTCGAGAAAGTCACGGCCTTCTTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-265s1c1
Sequence:CCGGGAGAGAAAGCAGATATGTTGTCTCGAGACAACATATCTGCTTTCTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-273s1c1
Sequence:CCGGGCAGATATGTTGTGTAACTCTCTCGAGAGAGTTACACAACATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128404    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_001005852.1-1733s1c1
Sequence:CCGGGCAGCTCTCTGTAAGAAATATCTCGAGATATTTCTTACAGAGAGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128432    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-373s1c1
Sequence:CCGGGCCGTGACTTTATAACAAAGACTCGAGTCTTTGTTATAAAGTCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129140    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_001005852.1-611s1c1
Sequence:CCGGGTCTCTTCAGACTCTAGAGTACTCGAGTACTCTAGAGTCTGAAGAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129236    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001005852.1-1183s1c1
Sequence:CCGGCCCAGAATATGCTTAGCAGATCTCGAGATCTGCTAAGCATATTCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks