EMAIL THIS PAGE TO A FRIEND

TXLNG

taxilin gamma

Synonyms: CXorf15 ELRG FIAT LSR5
UniProtKB ID: Q9NUQ3, Q2KQ75, Q5JNZ7, Q9P0X1
Gene ID:
Human(55787) Summary: This gene encodes a member of the taxilin family. The encoded protein binds to the C-terminal coiled-coil region of syntaxin family members 1A, 3A and 4A, and may play a role in intracellular vesicle trafficking. This gene is up-regulated by lipopolysaccharide and the gene product may be involved in cell cycle regulation. The related mouse protein was also shown to inhibit activating transcription factor 4-mediated transcription and thus regulate bone mass accrual. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2009]
Mouse(353170) taxilin gamma
Rat(302680) taxilin gamma
Zebrafish(324984) taxilin gamma
Horse(100056716) taxilin gamma
domestic cat(101097948) taxilin gamma
dog(480853) taxilin gamma
chicken(418618) taxilin gamma
cow(515927) taxilin gamma
sheep(101106399) taxilin gamma
71 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178935 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178935 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178935 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018360 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018360 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018360 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018360 Rosetta Predictions human pricing
NM_001037187 Rosetta Predictions rat pricing
NM_178935 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018360 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00189488 predicted 220
2 SASI_Hs01_00189489 predicted 740
3 SASI_Hs01_00189490 predicted 206
4 SASI_Hs01_00189491 predicted 1679
5 SASI_Hs01_00189492 predicted 1647
6 SASI_Hs01_00189493 predicted 246
7 SASI_Hs01_00189494 predicted 634
8 SASI_Hs01_00189496 predicted 773
9 SASI_Hs01_00189497 predicted 334
10 SASI_Hs02_00351823 predicted 1457
11 SASI_Hs01_00189495 predicted 419
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037187 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00204267 predicted 974
2 SASI_Rn02_00204268 predicted 841
3 SASI_Rn02_00204269 predicted 938
4 SASI_Rn02_00204270 predicted 846
5 SASI_Rn02_00204271 predicted 768
6 SASI_Rn02_00204272 predicted 903
7 SASI_Rn02_00204273 predicted 869
8 SASI_Rn02_00204274 predicted 286
9 SASI_Rn02_00204275 predicted 527
10 SASI_Rn02_00204276 predicted 741
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164341 predicted 229
2 SASI_Mm02_00349570 predicted 260
3 SASI_Mm01_00164343 predicted 782
4 SASI_Mm02_00349571 predicted 757
5 SASI_Mm01_00164345 predicted 1552
6 SASI_Mm01_00164346 predicted 679
7 SASI_Mm01_00164347 predicted 1632
8 SASI_Mm01_00164348 predicted 331
9 SASI_Mm01_00164349 predicted 1620
10 SASI_Mm02_00349572 predicted 659
11 SASI_Mm01_00164342 predicted 267
12 SASI_Mm01_00164344 predicted 680
13 SASI_Mm01_00164350 predicted 703
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178935
VALIDATED
TXLNG MISSION shRNA Bacterial Glycerol Stock
taxilin gamma
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-156s1c1
Sequence:CCGGCGCAGAAGTTTGAAATTGGCACTCGAGTGCCAATTTCAAACTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-815s1c1
Sequence:CCGGCAAGCTCAGTTGGAACAACATCTCGAGATGTTGTTCCAACTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178935.2-1684s1c1
Sequence:CCGGCCTCTGTTAGTAGTAACTATTCTCGAGAATAGTTACTACTAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000182349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-1409s1c1
Sequence:CCGGGAGAAGGTCGAAGTCCTGAAACTCGAGTTTCAGGACTTCGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-215s1c1
Sequence:CCGGGCAGACATGGTATGTAACTCTCTCGAGAGAGTTACATACCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-174s1c1
Sequence:CCGGGCACAATGGAAGAAGCTAGAACTCGAGTTCTAGCTTCTTCCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178935.2-707s1c1
Sequence:CCGGCAGCGTCATAATAAGACCTTACTCGAGTAAGGTCTTATTATGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178935.2-3624s1c1
Sequence:CCGGGCAGATATAGTTTGTGCTAAACTCGAGTTTAGCACAAACTATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-228s1c1
Sequence:CCGGGTAACTCTCAAGCAAATGATACTCGAGTATCATTTGCTTGAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178935.4-479s21c1
Sequence:CCGGATTACTGATGCAAGCGCTAAACTCGAGTTTAGCGCTTGCATCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178935.4-172s21c1
Sequence:CCGGGCACAATGGAAGAAGCTAGAACTCGAGTTCTAGCTTCTTCCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178935.4-2118s21c1
Sequence:CCGGACTCATAAAGTAGTCCTAATACTCGAGTATTAGGACTACTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178935.4-910s21c1
Sequence:CCGGCACTAAGGGAAGAGCATATTGCTCGAGCAATATGCTCTTCCCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178935.4-226s21c1
Sequence:CCGGGTAACTCTCAAGCAAATGATACTCGAGTATCATTTGCTTGAGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178935
VALIDATED
TXLNG MISSION shRNA shRNA Plasmid DNA
taxilin gamma
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-156s1c1
Sequence:CCGGCGCAGAAGTTTGAAATTGGCACTCGAGTGCCAATTTCAAACTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-815s1c1
Sequence:CCGGCAAGCTCAGTTGGAACAACATCTCGAGATGTTGTTCCAACTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178935.2-1684s1c1
Sequence:CCGGCCTCTGTTAGTAGTAACTATTCTCGAGAATAGTTACTACTAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000182349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-1409s1c1
Sequence:CCGGGAGAAGGTCGAAGTCCTGAAACTCGAGTTTCAGGACTTCGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-215s1c1
Sequence:CCGGGCAGACATGGTATGTAACTCTCTCGAGAGAGTTACATACCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-174s1c1
Sequence:CCGGGCACAATGGAAGAAGCTAGAACTCGAGTTCTAGCTTCTTCCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178935.2-707s1c1
Sequence:CCGGCAGCGTCATAATAAGACCTTACTCGAGTAAGGTCTTATTATGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178935.2-3624s1c1
Sequence:CCGGGCAGATATAGTTTGTGCTAAACTCGAGTTTAGCACAAACTATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-228s1c1
Sequence:CCGGGTAACTCTCAAGCAAATGATACTCGAGTATCATTTGCTTGAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178935.4-479s21c1
Sequence:CCGGATTACTGATGCAAGCGCTAAACTCGAGTTTAGCGCTTGCATCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178935.4-172s21c1
Sequence:CCGGGCACAATGGAAGAAGCTAGAACTCGAGTTCTAGCTTCTTCCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178935.4-2118s21c1
Sequence:CCGGACTCATAAAGTAGTCCTAATACTCGAGTATTAGGACTACTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178935.4-910s21c1
Sequence:CCGGCACTAAGGGAAGAGCATATTGCTCGAGCAATATGCTCTTCCCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178935.4-226s21c1
Sequence:CCGGGTAACTCTCAAGCAAATGATACTCGAGTATCATTTGCTTGAGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178935
VALIDATED
TXLNG MISSION shRNA Lentiviral Transduction Particles
taxilin gamma
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198753    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-156s1c1
Sequence:CCGGCGCAGAAGTTTGAAATTGGCACTCGAGTGCCAATTTCAAACTTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-815s1c1
Sequence:CCGGCAAGCTCAGTTGGAACAACATCTCGAGATGTTGTTCCAACTGAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197450    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178935.2-1684s1c1
Sequence:CCGGCCTCTGTTAGTAGTAACTATTCTCGAGAATAGTTACTACTAACAGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000182349    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-1409s1c1
Sequence:CCGGGAGAAGGTCGAAGTCCTGAAACTCGAGTTTCAGGACTTCGACCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181588    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178935.2-215s1c1
Sequence:CCGGGCAGACATGGTATGTAACTCTCTCGAGAGAGTTACATACCATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-174s1c1
Sequence:CCGGGCACAATGGAAGAAGCTAGAACTCGAGTTCTAGCTTCTTCCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177913    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178935.2-707s1c1
Sequence:CCGGCAGCGTCATAATAAGACCTTACTCGAGTAAGGTCTTATTATGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177423    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178935.2-3624s1c1
Sequence:CCGGGCAGATATAGTTTGTGCTAAACTCGAGTTTAGCACAAACTATATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_178935.2-228s1c1
Sequence:CCGGGTAACTCTCAAGCAAATGATACTCGAGTATCATTTGCTTGAGAGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279502    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178935.4-479s21c1
Sequence:CCGGATTACTGATGCAAGCGCTAAACTCGAGTTTAGCGCTTGCATCAGTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279429    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178935.4-172s21c1
Sequence:CCGGGCACAATGGAAGAAGCTAGAACTCGAGTTCTAGCTTCTTCCATTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279430    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178935.4-2118s21c1
Sequence:CCGGACTCATAAAGTAGTCCTAATACTCGAGTATTAGGACTACTTTATGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279431    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178935.4-910s21c1
Sequence:CCGGCACTAAGGGAAGAGCATATTGCTCGAGCAATATGCTCTTCCCTTAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278692    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178935.4-226s21c1
Sequence:CCGGGTAACTCTCAAGCAAATGATACTCGAGTATCATTTGCTTGAGAGTTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018360
VALIDATED
TXLNG MISSION shRNA Bacterial Glycerol Stock
taxilin gamma
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-576s1c1
Sequence:CCGGGCAAATGAAGATCCTGCAGAACTCGAGTTCTGCAGGATCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018360.1-636s1c1
Sequence:CCGGGAGTGAACATAGCAAGGCTATCTCGAGATAGCCTTGCTATGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-254s1c1
Sequence:CCGGGCTCAAATTGTGGTGGCACAACTCGAGTTGTGCCACCACAATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-975s1c1
Sequence:CCGGGCAGCAAACGACACAACTGATCTCGAGATCAGTTGTGTCGTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-757s1c1
Sequence:CCGGCGACGTAAAGAAGCAACTGCACTCGAGTGCAGTTGCTTCTTTACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018360.1-1860s1c1
Sequence:CCGGCTCCACTGGAATGCATGTGTTCTCGAGAACACATGCATTCCAGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-164s1c1
Sequence:CCGGGCACAATGGAAGAAGCTGGAACTCGAGTTCCAGCTTCTTCCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-697s1c1
Sequence:CCGGCAGCGTCACAATAAGACGTTACTCGAGTAACGTCTTATTGTGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-269s1c1
Sequence:CCGGGCACAAGTAACAAGCATTCATCTCGAGATGAATGCTTGTTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018360.1-783s1c1
Sequence:CCGGCCAGATTACCTTAGATGAAATCTCGAGATTTCATCTAAGGTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-357s1c1
Sequence:CCGGGCAAGAATCAAGAGAGGAAATCTCGAGATTTCCTCTCTTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-978s1c1
Sequence:CCGGGCAAACGACACAACTGATAAACTCGAGTTTATCAGTTGTGTCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018360
VALIDATED
TXLNG MISSION shRNA shRNA Plasmid DNA
taxilin gamma
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-576s1c1
Sequence:CCGGGCAAATGAAGATCCTGCAGAACTCGAGTTCTGCAGGATCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018360.1-636s1c1
Sequence:CCGGGAGTGAACATAGCAAGGCTATCTCGAGATAGCCTTGCTATGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-254s1c1
Sequence:CCGGGCTCAAATTGTGGTGGCACAACTCGAGTTGTGCCACCACAATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-975s1c1
Sequence:CCGGGCAGCAAACGACACAACTGATCTCGAGATCAGTTGTGTCGTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-757s1c1
Sequence:CCGGCGACGTAAAGAAGCAACTGCACTCGAGTGCAGTTGCTTCTTTACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018360.1-1860s1c1
Sequence:CCGGCTCCACTGGAATGCATGTGTTCTCGAGAACACATGCATTCCAGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-164s1c1
Sequence:CCGGGCACAATGGAAGAAGCTGGAACTCGAGTTCCAGCTTCTTCCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-697s1c1
Sequence:CCGGCAGCGTCACAATAAGACGTTACTCGAGTAACGTCTTATTGTGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-269s1c1
Sequence:CCGGGCACAAGTAACAAGCATTCATCTCGAGATGAATGCTTGTTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018360.1-783s1c1
Sequence:CCGGCCAGATTACCTTAGATGAAATCTCGAGATTTCATCTAAGGTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-357s1c1
Sequence:CCGGGCAAGAATCAAGAGAGGAAATCTCGAGATTTCCTCTCTTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-978s1c1
Sequence:CCGGGCAAACGACACAACTGATAAACTCGAGTTTATCAGTTGTGTCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018360
VALIDATED
TXLNG MISSION shRNA Lentiviral Transduction Particles
taxilin gamma
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-576s1c1
Sequence:CCGGGCAAATGAAGATCCTGCAGAACTCGAGTTCTGCAGGATCTTCATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018360.1-636s1c1
Sequence:CCGGGAGTGAACATAGCAAGGCTATCTCGAGATAGCCTTGCTATGTTCACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140635    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-254s1c1
Sequence:CCGGGCTCAAATTGTGGTGGCACAACTCGAGTTGTGCCACCACAATTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139886    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-975s1c1
Sequence:CCGGGCAGCAAACGACACAACTGATCTCGAGATCAGTTGTGTCGTTTGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139267    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-757s1c1
Sequence:CCGGCGACGTAAAGAAGCAACTGCACTCGAGTGCAGTTGCTTCTTTACGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139266    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_018360.1-1860s1c1
Sequence:CCGGCTCCACTGGAATGCATGTGTTCTCGAGAACACATGCATTCCAGTGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140138    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-164s1c1
Sequence:CCGGGCACAATGGAAGAAGCTGGAACTCGAGTTCCAGCTTCTTCCATTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142856    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-697s1c1
Sequence:CCGGCAGCGTCACAATAAGACGTTACTCGAGTAACGTCTTATTGTGACGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121858    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-269s1c1
Sequence:CCGGGCACAAGTAACAAGCATTCATCTCGAGATGAATGCTTGTTACTTGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121522    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018360.1-783s1c1
Sequence:CCGGCCAGATTACCTTAGATGAAATCTCGAGATTTCATCTAAGGTAATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144613    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018360.1-357s1c1
Sequence:CCGGGCAAGAATCAAGAGAGGAAATCTCGAGATTTCCTCTCTTGATTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144587    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_018360.1-978s1c1
Sequence:CCGGGCAAACGACACAACTGATAAACTCGAGTTTATCAGTTGTGTCGTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks