EMAIL THIS PAGE TO A FRIEND

TXN2

thioredoxin 2

Synonyms: MT-TRX MTRX TRX2
UniProtKB ID: Q99757, Q5JZA0, Q6FH60, Q9UH29
Gene ID:
Human(25828) Summary: This nuclear gene encodes a mitochondrial member of the thioredoxin family, a group of small multifunctional redox-active proteins. The encoded protein may play important roles in the regulation of the mitochondrial membrane potential and in protection against oxidant-induced apoptosis. [provided by RefSeq, Jul 2008]
Mouse(56551) thioredoxin 2
Rat(79462) thioredoxin 2
cow(281557) thioredoxin 2
sheep(101121670) thioredoxin 2
Zebrafish(402938) thioredoxin 2
domestic cat(101094029) thioredoxin 2
dog(474519) thioredoxin 2
chicken(426978) thioredoxin 2
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012473 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012473 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012473 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_019913 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_019913 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_019913 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012473 Rosetta Predictions human pricing
NM_053331 Rosetta Predictions rat pricing
NM_019913 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012473 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00205138 predicted 309
2 SASI_Hs01_00205139 predicted 208
3 SASI_Hs01_00205140 predicted 712
4 SASI_Hs01_00205141 predicted 223
5 SASI_Hs01_00205142 predicted 434
6 SASI_Hs01_00205143 predicted 444
7 SASI_Hs01_00205144 predicted 264
8 SASI_Hs01_00205145 predicted 297
9 SASI_Hs01_00205146 predicted 314
10 SASI_Hs01_00205147 predicted 293
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053331 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00098902 predicted 338
2 SASI_Rn01_00098904 predicted 220
3 SASI_Rn02_00265784 predicted 425
4 SASI_Rn02_00265785 predicted 827
5 SASI_Rn02_00265786 predicted 251
6 SASI_Rn01_00098911 predicted 834
7 SASI_Rn02_00265787 predicted 807
8 SASI_Rn02_00265788 predicted 428
9 SASI_Rn02_00265789 predicted 455
10 SASI_Rn02_00265790 predicted 760
11 SASI_Rn01_00098903 predicted 1040
12 SASI_Rn01_00098905 predicted 345
13 SASI_Rn01_00098906 predicted 296
14 SASI_Rn01_00098907 predicted 929
15 SASI_Rn01_00098908 predicted 1039
16 SASI_Rn01_00098909 predicted 1038
17 SASI_Rn01_00098910 predicted 806
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_019913 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00126997 predicted 448
2 SASI_Mm01_00126998 predicted 282
3 SASI_Mm01_00126999 predicted 232
4 SASI_Mm01_00127000 predicted 364
5 SASI_Mm01_00127001 predicted 481
6 SASI_Mm01_00127002 predicted 260
7 SASI_Mm01_00127003 predicted 458
8 SASI_Mm01_00127004 predicted 314
9 SASI_Mm01_00127005 predicted 587
10 SASI_Mm01_00127006 predicted 859
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012473
VALIDATED
TXN2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin 2
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-374s1c1
Sequence:CCGGGTTAGAGAAGATGGTGGCCAACTCGAGTTGGCCACCATCTTCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-411s1c1
Sequence:CCGGGTGATGGCCAAGGTGGATATTCTCGAGAATATCCACCTTGGCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012473.3-552s1c1
Sequence:CCGGGCCTTCCTGAAGAAGCTGATTCTCGAGAATCAGCTTCTTCAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012473.3-245s1c1
Sequence:CCGGGATCTCCTTGACAACCTTTAACTCGAGTTAAAGGTTGTCAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-227s1c1
Sequence:CCGGGACAATATACACCACGAGGATCTCGAGATCCTCGTGGTGTATATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000377410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-442s21c1
Sequence:CCGGCAGACCTCGCCATTGAGTATGCTCGAGCATACTCAATGGCGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-552s21c1
Sequence:CCGGGCCTTCCTGAAGAAGCTGATTCTCGAGAATCAGCTTCTTCAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-245s21c1
Sequence:CCGGGATCTCCTTGACAACCTTTAACTCGAGTTAAAGGTTGTCAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-411s21c1
Sequence:CCGGGTGATGGCCAAGGTGGATATTCTCGAGAATATCCACCTTGGCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012473.3-946s21c1
Sequence:CCGGGCTCGTCTGCCACCTACATTTCTCGAGAAATGTAGGTGGCAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012473.3-1017s21c1
Sequence:CCGGCTAGTGAGAGTAATATCTAATCTCGAGATTAGATATTACTCTCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012473
VALIDATED
TXN2 MISSION shRNA shRNA Plasmid DNA
thioredoxin 2
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-374s1c1
Sequence:CCGGGTTAGAGAAGATGGTGGCCAACTCGAGTTGGCCACCATCTTCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-411s1c1
Sequence:CCGGGTGATGGCCAAGGTGGATATTCTCGAGAATATCCACCTTGGCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012473.3-552s1c1
Sequence:CCGGGCCTTCCTGAAGAAGCTGATTCTCGAGAATCAGCTTCTTCAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012473.3-245s1c1
Sequence:CCGGGATCTCCTTGACAACCTTTAACTCGAGTTAAAGGTTGTCAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-227s1c1
Sequence:CCGGGACAATATACACCACGAGGATCTCGAGATCCTCGTGGTGTATATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000377410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-442s21c1
Sequence:CCGGCAGACCTCGCCATTGAGTATGCTCGAGCATACTCAATGGCGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-552s21c1
Sequence:CCGGGCCTTCCTGAAGAAGCTGATTCTCGAGAATCAGCTTCTTCAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-245s21c1
Sequence:CCGGGATCTCCTTGACAACCTTTAACTCGAGTTAAAGGTTGTCAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-411s21c1
Sequence:CCGGGTGATGGCCAAGGTGGATATTCTCGAGAATATCCACCTTGGCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012473.3-946s21c1
Sequence:CCGGGCTCGTCTGCCACCTACATTTCTCGAGAAATGTAGGTGGCAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012473.3-1017s21c1
Sequence:CCGGCTAGTGAGAGTAATATCTAATCTCGAGATTAGATATTACTCTCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012473
VALIDATED
TXN2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin 2
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064199    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-374s1c1
Sequence:CCGGGTTAGAGAAGATGGTGGCCAACTCGAGTTGGCCACCATCTTCTCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064202    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-411s1c1
Sequence:CCGGGTGATGGCCAAGGTGGATATTCTCGAGAATATCCACCTTGGCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064201    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_012473.3-552s1c1
Sequence:CCGGGCCTTCCTGAAGAAGCTGATTCTCGAGAATCAGCTTCTTCAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064200    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_012473.3-245s1c1
Sequence:CCGGGATCTCCTTGACAACCTTTAACTCGAGTTAAAGGTTGTCAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064198    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012473.3-227s1c1
Sequence:CCGGGACAATATACACCACGAGGATCTCGAGATCCTCGTGGTGTATATTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000377410    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-442s21c1
Sequence:CCGGCAGACCTCGCCATTGAGTATGCTCGAGCATACTCAATGGCGAGGTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363744    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-552s21c1
Sequence:CCGGGCCTTCCTGAAGAAGCTGATTCTCGAGAATCAGCTTCTTCAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-245s21c1
Sequence:CCGGGATCTCCTTGACAACCTTTAACTCGAGTTAAAGGTTGTCAAGGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012473.3-411s21c1
Sequence:CCGGGTGATGGCCAAGGTGGATATTCTCGAGAATATCCACCTTGGCCATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344835    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012473.3-946s21c1
Sequence:CCGGGCTCGTCTGCCACCTACATTTCTCGAGAAATGTAGGTGGCAGACGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_012473.3-1017s21c1
Sequence:CCGGCTAGTGAGAGTAATATCTAATCTCGAGATTAGATATTACTCTCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_019913
VALIDATED
TXN2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin 2
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019913.3-1055s1c1
Sequence:CCGGCGAACAAGTGAGAGTAATGTACTCGAGTACATTACTCTCACTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-255s1c1
Sequence:CCGGAGAGTCTGTTTGACGACCTTTCTCGAGAAAGGTCGTCAAACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-386s1c1
Sequence:CCGGGCTAGAGAAGATGGTCGCCAACTCGAGTTGGCGACCATCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-327s1c1
Sequence:CCGGCCAGTTGTTGTGGACTTTCATCTCGAGATGAAAGTCCACAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-291s1c1
Sequence:CCGGCCTGACTTTCAAGACAGAGTTCTCGAGAACTCTGTCTTGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-1051s21c1
Sequence:CCGGAGCCGAACAAGTGAGAGTAATCTCGAGATTACTCTCACTTGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-196s21c1
Sequence:CCGGGTACAATGCTGGTGGTCTAACCTCGAGGTTAGACCACCAGCATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000366233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-255s21c1
Sequence:CCGGGAGTCTGTTTGACGACCTTTACTCGAGTAAAGGTCGTCAAACAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-423s21c1
Sequence:CCGGTCATGGCCAAAGTGGACATTGCTCGAGCAATGTCCACTTTGGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-452s21c1
Sequence:CCGGACAGACCTTGCCATTGAATATCTCGAGATATTCAATGGCAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-997s21c1
Sequence:CCGGGCATCAGCCTCTGGCACATTTCTCGAGAAATGTGCCAGAGGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_019913
VALIDATED
TXN2 MISSION shRNA shRNA Plasmid DNA
thioredoxin 2
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019913.3-1055s1c1
Sequence:CCGGCGAACAAGTGAGAGTAATGTACTCGAGTACATTACTCTCACTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-255s1c1
Sequence:CCGGAGAGTCTGTTTGACGACCTTTCTCGAGAAAGGTCGTCAAACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-386s1c1
Sequence:CCGGGCTAGAGAAGATGGTCGCCAACTCGAGTTGGCGACCATCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-327s1c1
Sequence:CCGGCCAGTTGTTGTGGACTTTCATCTCGAGATGAAAGTCCACAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-291s1c1
Sequence:CCGGCCTGACTTTCAAGACAGAGTTCTCGAGAACTCTGTCTTGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-1051s21c1
Sequence:CCGGAGCCGAACAAGTGAGAGTAATCTCGAGATTACTCTCACTTGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-196s21c1
Sequence:CCGGGTACAATGCTGGTGGTCTAACCTCGAGGTTAGACCACCAGCATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000366233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-255s21c1
Sequence:CCGGGAGTCTGTTTGACGACCTTTACTCGAGTAAAGGTCGTCAAACAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-423s21c1
Sequence:CCGGTCATGGCCAAAGTGGACATTGCTCGAGCAATGTCCACTTTGGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-452s21c1
Sequence:CCGGACAGACCTTGCCATTGAATATCTCGAGATATTCAATGGCAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-997s21c1
Sequence:CCGGGCATCAGCCTCTGGCACATTTCTCGAGAAATGTGCCAGAGGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_019913
VALIDATED
TXN2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin 2
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114361    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_019913.3-1055s1c1
Sequence:CCGGCGAACAAGTGAGAGTAATGTACTCGAGTACATTACTCTCACTTGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114364    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-255s1c1
Sequence:CCGGAGAGTCTGTTTGACGACCTTTCTCGAGAAAGGTCGTCAAACAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114365    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-386s1c1
Sequence:CCGGGCTAGAGAAGATGGTCGCCAACTCGAGTTGGCGACCATCTTCTCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114363    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-327s1c1
Sequence:CCGGCCAGTTGTTGTGGACTTTCATCTCGAGATGAAAGTCCACAACAACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114362    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_019913.3-291s1c1
Sequence:CCGGCCTGACTTTCAAGACAGAGTTCTCGAGAACTCTGTCTTGAAAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366234    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-1051s21c1
Sequence:CCGGAGCCGAACAAGTGAGAGTAATCTCGAGATTACTCTCACTTGTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366235    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-196s21c1
Sequence:CCGGGTACAATGCTGGTGGTCTAACCTCGAGGTTAGACCACCAGCATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000366233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-255s21c1
Sequence:CCGGGAGTCTGTTTGACGACCTTTACTCGAGTAAAGGTCGTCAAACAGACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374795    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-423s21c1
Sequence:CCGGTCATGGCCAAAGTGGACATTGCTCGAGCAATGTCCACTTTGGCCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374862    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-452s21c1
Sequence:CCGGACAGACCTTGCCATTGAATATCTCGAGATATTCAATGGCAAGGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374861    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_019913.5-997s21c1
Sequence:CCGGGCATCAGCCTCTGGCACATTTCTCGAGAAATGTGCCAGAGGCTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks