EMAIL THIS PAGE TO A FRIEND

TXN

thioredoxin

Synonyms: TRDX TRX TRX1
UniProtKB ID: P10599, B1ALW1, O60744, Q53X69, Q96KI3, Q9UDG5
Gene ID:
Human(7295) Summary: The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
Zebrafish(436734) thioredoxin
Horse(100033827) thioredoxin
chicken(396437) thioredoxin
cow(280950) thioredoxin
sheep(443439) thioredoxin
33 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_003329 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003329 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003329 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU112621 MISSION® esiRNA esiRNA human TXN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003329 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003329 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155039 predicted 207
2 SASI_Hs01_00155041 predicted 102
3 SASI_Hs01_00155042 predicted 463
4 SASI_Hs02_00335475 predicted 468
5 SASI_Hs01_00155046 predicted 471
6 SASI_Hs02_00335476 predicted 94
7 SASI_Hs01_00155040 predicted 110
8 SASI_Hs02_00335477 predicted 268
9 SASI_Hs02_00335478 predicted 249
10 SASI_Hs01_00155043 predicted 218
11 SASI_Hs01_00155044 predicted 346
12 SASI_Hs01_00155045 predicted 235
13 SASI_Hs01_00155047 predicted 358
14 SASI_Hs01_00155048 predicted 366
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003329
VALIDATED
TXN MISSION shRNA Bacterial Glycerol Stock
thioredoxin
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-115s1c1
Sequence:CCGGGCAGGTGATAAACTTGTAGTACTCGAGTACTACAAGTTTATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-269s1c1
Sequence:CCGGGTGAAGTCAAATGCACGCCAACTCGAGTTGGCGTGCATTTGACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-211s1c1
Sequence:CCGGTCCAACGTGATATTCCTTGAACTCGAGTTCAAGGAATATCACGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-235s1c1
Sequence:CCGGGATGTGGATGACTGTCAGGATCTCGAGATCCTGACAGTCATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-259s1c1
Sequence:CCGGGCTTCAGAGTGTGAAGTCAAACTCGAGTTTGACTTCACACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003329.2-175s21c1
Sequence:CCGGATCAAGCCTTTCTTTCATTCCCTCGAGGGAATGAAAGAAAGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003329.2-329s21c1
Sequence:CCGGTTTCTGGAGCCAATAAGGAAACTCGAGTTTCCTTATTGGCTCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003329.2-235s21c1
Sequence:CCGGGATGTGGATGACTGTCAGGATCTCGAGATCCTGACAGTCATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003329
VALIDATED
TXN MISSION shRNA shRNA Plasmid DNA
thioredoxin
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-115s1c1
Sequence:CCGGGCAGGTGATAAACTTGTAGTACTCGAGTACTACAAGTTTATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-269s1c1
Sequence:CCGGGTGAAGTCAAATGCACGCCAACTCGAGTTGGCGTGCATTTGACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-211s1c1
Sequence:CCGGTCCAACGTGATATTCCTTGAACTCGAGTTCAAGGAATATCACGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-235s1c1
Sequence:CCGGGATGTGGATGACTGTCAGGATCTCGAGATCCTGACAGTCATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-259s1c1
Sequence:CCGGGCTTCAGAGTGTGAAGTCAAACTCGAGTTTGACTTCACACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003329.2-175s21c1
Sequence:CCGGATCAAGCCTTTCTTTCATTCCCTCGAGGGAATGAAAGAAAGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003329.2-329s21c1
Sequence:CCGGTTTCTGGAGCCAATAAGGAAACTCGAGTTTCCTTATTGGCTCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003329.2-235s21c1
Sequence:CCGGGATGTGGATGACTGTCAGGATCTCGAGATCCTGACAGTCATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003329
VALIDATED
TXN MISSION shRNA Lentiviral Transduction Particles
thioredoxin
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-115s1c1
Sequence:CCGGGCAGGTGATAAACTTGTAGTACTCGAGTACTACAAGTTTATCACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064281    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-269s1c1
Sequence:CCGGGTGAAGTCAAATGCACGCCAACTCGAGTTGGCGTGCATTTGACTTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064282    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-211s1c1
Sequence:CCGGTCCAACGTGATATTCCTTGAACTCGAGTTCAAGGAATATCACGTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064280    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-235s1c1
Sequence:CCGGGATGTGGATGACTGTCAGGATCTCGAGATCCTGACAGTCATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064279    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_003329.1-259s1c1
Sequence:CCGGGCTTCAGAGTGTGAAGTCAAACTCGAGTTTGACTTCACACTCTGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 2 Clone ID:NM_003329.2-175s21c1
Sequence:CCGGATCAAGCCTTTCTTTCATTCCCTCGAGGGAATGAAAGAAAGGCTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369872    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003329.2-329s21c1
Sequence:CCGGTTTCTGGAGCCAATAAGGAAACTCGAGTTTCCTTATTGGCTCCAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289658    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_003329.2-235s21c1
Sequence:CCGGGATGTGGATGACTGTCAGGATCTCGAGATCCTGACAGTCATCCACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks