EMAIL THIS PAGE TO A FRIEND

TXNDC11

thioredoxin domain containing 11

Synonyms: EFP1
UniProtKB ID: Q6PKC3, O95887, Q6PJA6, Q8N2Q4, Q96K45, Q96K53
Gene ID:
Mouse(106200) thioredoxin domain containing 11
Rat(302899) thioredoxin domain containing 11
Zebrafish(449852) thioredoxin domain containing 11
dog(490003) thioredoxin domain containing 11
chicken(416428) thioredoxin domain containing 11
Horse(100056118) thioredoxin domain containing 11
domestic cat(101083053) thioredoxin domain containing 11
cow(513509) thioredoxin domain containing 11
sheep(101108359) thioredoxin domain containing 11
naked mole-rat(101723393) thioredoxin domain containing 11
Domestic Rabbit(100349396) thioredoxin domain containing 11
domestic guinea pig(100730030) thioredoxin domain containing 11
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015914 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015914 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015914 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134105 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134105 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134105 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015914 Rosetta Predictions human pricing
NM_001127532 Rosetta Predictions rat pricing
XR_009202 Rosetta Predictions rat pricing
NM_029582 Rosetta Predictions mouse pricing
NM_134105 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015914 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00153575 predicted 1520
2 SASI_Hs01_00153577 predicted 1575
3 SASI_Hs01_00153578 predicted 1907
4 SASI_Hs02_00348526 predicted 1979
5 SASI_Hs01_00153579 predicted 409
6 SASI_Hs02_00348527 predicted 2203
7 SASI_Hs01_00153581 predicted 1004
8 SASI_Hs01_00153583 predicted 880
9 SASI_Hs01_00153584 predicted 1779
10 SASI_Hs02_00348528 predicted 1666
11 SASI_Hs01_00153576 predicted 655
12 SASI_Hs01_00153580 predicted 913
13 SASI_Hs01_00153582 predicted 1624
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127532 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254073 predicted 1174
2 SASI_Rn02_00254074 predicted 953
3 SASI_Rn02_00254075 predicted 935
4 SASI_Rn02_00254076 predicted 800
5 SASI_Rn02_00254077 predicted 852
6 SASI_Rn02_00254078 predicted 1827
7 SASI_Rn02_00254079 predicted 1950
8 SASI_Rn02_00254080 predicted 1598
9 SASI_Rn02_00254081 predicted 1121
10 SASI_Rn02_00254082 predicted 1791
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_009202 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00124232 predicted 4277
2 SASI_Rn01_00124233 predicted 723
3 SASI_Rn01_00124234 predicted 4171
4 SASI_Rn01_00124235 predicted 1198
5 SASI_Rn01_00124236 predicted 972
6 SASI_Rn01_00124237 predicted 1593
7 SASI_Rn01_00124238 predicted 959
8 SASI_Rn01_00124239 predicted 2969
9 SASI_Rn01_00124240 predicted 3958
10 SASI_Rn01_00124241 predicted 1622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029582 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00335537 predicted 2097
2 SASI_Mm02_00335538 predicted 2157
3 SASI_Mm02_00335539 predicted 1961
4 SASI_Mm02_00335540 predicted 2045
5 SASI_Mm02_00335541 predicted 2174
6 SASI_Mm02_00335542 predicted 2344
7 SASI_Mm02_00335543 predicted 2155
8 SASI_Mm02_00335544 predicted 2271
9 SASI_Mm02_00335545 predicted 2170
10 SASI_Mm02_00335546 predicted 1997
11 SASI_Mm01_00096664 predicted 613
12 SASI_Mm01_00096665 predicted 1094
13 SASI_Mm01_00096666 predicted 1834
14 SASI_Mm01_00096667 predicted 1863
15 SASI_Mm01_00096668 predicted 1499
16 SASI_Mm01_00096669 predicted 1611
17 SASI_Mm01_00096670 predicted 1834
18 SASI_Mm01_00096671 predicted 1741
19 SASI_Mm01_00096672 predicted 857
20 SASI_Mm01_00096673 predicted 2166
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134105 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00181684 predicted 343
2 SASI_Mm01_00181685 predicted 401
3 SASI_Mm01_00181686 predicted 199
4 SASI_Mm01_00181687 predicted 294
5 SASI_Mm01_00181688 predicted 414
6 SASI_Mm01_00181689 predicted 593
7 SASI_Mm01_00181690 predicted 401
8 SASI_Mm01_00181691 predicted 513
9 SASI_Mm01_00181692 predicted 412
10 SASI_Mm01_00181693 predicted 235
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015914
VALIDATED
TXNDC11 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 11
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000336805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2106s21c1
Sequence:CCGGGACGTTCTCCTGCTCTATTACCTCGAGGTAATAGAGCAGGAGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-1143s21c1
Sequence:CCGGGCCGAAAGTCATCCTTTAATACTCGAGTATTAAAGGATGACTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2258s21c1
Sequence:CCGGCGATCGTCTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAGACGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2343s21c1
Sequence:CCGGCCAAACCTGTTGAGGTTCATTCTCGAGAATGAACCTCAACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000336724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-986s21c1
Sequence:CCGGCCTGAACTACACAGCTGAGAACTCGAGTTCTCAGCTGTGTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000131001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-986s1c1
Sequence:CCGGCCTGAACTACACAGCTGAGAACTCGAGTTCTCAGCTGTGTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-1674s1c1
Sequence:CCGGGAGAAGAAATGTGAGGTTGATCTCGAGATCAACCTCACATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015914.5-405s1c1
Sequence:CCGGCTGGATTATGCAGAGTACGTTCTCGAGAACGTACTCTGCATAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-2343s1c1
Sequence:CCGGCCAAACCTGTTGAGGTTCATTCTCGAGAATGAACCTCAACAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000128571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-1143s1c1
Sequence:CCGGGCCGAAAGTCATCCTTTAATACTCGAGTATTAAAGGATGACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-2258s1c1
Sequence:CCGGCGATCGTCTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAGACGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015914
VALIDATED
TXNDC11 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 11
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000336805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2106s21c1
Sequence:CCGGGACGTTCTCCTGCTCTATTACCTCGAGGTAATAGAGCAGGAGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-1143s21c1
Sequence:CCGGGCCGAAAGTCATCCTTTAATACTCGAGTATTAAAGGATGACTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2258s21c1
Sequence:CCGGCGATCGTCTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAGACGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2343s21c1
Sequence:CCGGCCAAACCTGTTGAGGTTCATTCTCGAGAATGAACCTCAACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000336724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-986s21c1
Sequence:CCGGCCTGAACTACACAGCTGAGAACTCGAGTTCTCAGCTGTGTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000131001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-986s1c1
Sequence:CCGGCCTGAACTACACAGCTGAGAACTCGAGTTCTCAGCTGTGTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-1674s1c1
Sequence:CCGGGAGAAGAAATGTGAGGTTGATCTCGAGATCAACCTCACATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015914.5-405s1c1
Sequence:CCGGCTGGATTATGCAGAGTACGTTCTCGAGAACGTACTCTGCATAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-2343s1c1
Sequence:CCGGCCAAACCTGTTGAGGTTCATTCTCGAGAATGAACCTCAACAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000128571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-1143s1c1
Sequence:CCGGGCCGAAAGTCATCCTTTAATACTCGAGTATTAAAGGATGACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-2258s1c1
Sequence:CCGGCGATCGTCTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAGACGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015914
VALIDATED
TXNDC11 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 11
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000336805    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2106s21c1
Sequence:CCGGGACGTTCTCCTGCTCTATTACCTCGAGGTAATAGAGCAGGAGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-1143s21c1
Sequence:CCGGGCCGAAAGTCATCCTTTAATACTCGAGTATTAAAGGATGACTTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336726    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2258s21c1
Sequence:CCGGCGATCGTCTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAGACGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336727    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-2343s21c1
Sequence:CCGGCCAAACCTGTTGAGGTTCATTCTCGAGAATGAACCTCAACAGGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000336724    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: A549
TRC Version: 2 Clone ID:NM_015914.5-986s21c1
Sequence:CCGGCCTGAACTACACAGCTGAGAACTCGAGTTCTCAGCTGTGTAGTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000131001    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-986s1c1
Sequence:CCGGCCTGAACTACACAGCTGAGAACTCGAGTTCTCAGCTGTGTAGTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130023    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-1674s1c1
Sequence:CCGGGAGAAGAAATGTGAGGTTGATCTCGAGATCAACCTCACATTTCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015914.5-405s1c1
Sequence:CCGGCTGGATTATGCAGAGTACGTTCTCGAGAACGTACTCTGCATAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130589    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-2343s1c1
Sequence:CCGGCCAAACCTGTTGAGGTTCATTCTCGAGAATGAACCTCAACAGGTTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000128571    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-1143s1c1
Sequence:CCGGGCCGAAAGTCATCCTTTAATACTCGAGTATTAAAGGATGACTTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_015914.5-2258s1c1
Sequence:CCGGCGATCGTCTTCCTACTGTCTTCTCGAGAAGACAGTAGGAAGACGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134105
VALIDATED
TXNDC11 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 11
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000325737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-342s21c1
Sequence:CCGGGTCTCTCAATCACATCTTCATCTCGAGATGAAGATGTGATTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-298s21c1
Sequence:CCGGGACGTTCTGCTGCTCTATTATCTCGAGATAATAGAGCAGCAGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-249s21c1
Sequence:CCGGCACGGAAGTGACGACTGATACCTCGAGGTATCAGTCGTCACTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-422s21c1
Sequence:CCGGAGAATGATCTTCCTTGGGAATCTCGAGATTCCCAAGGAAGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-479s21c1
Sequence:CCGGCCTGCAATAGAAAGGACCTAACTCGAGTTAGGTCCTTTCTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-367s1c1
Sequence:CCGGGTCTCTCAATCACATCTTCATCTCGAGATGAAGATGTGATTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134105.1-504s1c1
Sequence:CCGGCCTGCAATAGAAAGGACCTAACTCGAGTTAGGTCCTTTCTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-544s1c1
Sequence:CCGGCCTCCCTATCACCCTCCCGAACTCGAGTTCGGGAGGGTGATAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-572s1c1
Sequence:CCGGCGGTTCATTCTGCATCACTCACTCGAGTGAGTGATGCAGAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-447s1c1
Sequence:CCGGAGAATGATCTTCCTTGGGAATCTCGAGATTCCCAAGGAAGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134105
VALIDATED
TXNDC11 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 11
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000325737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-342s21c1
Sequence:CCGGGTCTCTCAATCACATCTTCATCTCGAGATGAAGATGTGATTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-298s21c1
Sequence:CCGGGACGTTCTGCTGCTCTATTATCTCGAGATAATAGAGCAGCAGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-249s21c1
Sequence:CCGGCACGGAAGTGACGACTGATACCTCGAGGTATCAGTCGTCACTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-422s21c1
Sequence:CCGGAGAATGATCTTCCTTGGGAATCTCGAGATTCCCAAGGAAGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-479s21c1
Sequence:CCGGCCTGCAATAGAAAGGACCTAACTCGAGTTAGGTCCTTTCTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-367s1c1
Sequence:CCGGGTCTCTCAATCACATCTTCATCTCGAGATGAAGATGTGATTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134105.1-504s1c1
Sequence:CCGGCCTGCAATAGAAAGGACCTAACTCGAGTTAGGTCCTTTCTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-544s1c1
Sequence:CCGGCCTCCCTATCACCCTCCCGAACTCGAGTTCGGGAGGGTGATAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-572s1c1
Sequence:CCGGCGGTTCATTCTGCATCACTCACTCGAGTGAGTGATGCAGAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-447s1c1
Sequence:CCGGAGAATGATCTTCCTTGGGAATCTCGAGATTCCCAAGGAAGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134105
VALIDATED
TXNDC11 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 11
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000325737    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-342s21c1
Sequence:CCGGGTCTCTCAATCACATCTTCATCTCGAGATGAAGATGTGATTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-298s21c1
Sequence:CCGGGACGTTCTGCTGCTCTATTATCTCGAGATAATAGAGCAGCAGAACGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306029    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-249s21c1
Sequence:CCGGCACGGAAGTGACGACTGATACCTCGAGGTATCAGTCGTCACTTCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-422s21c1
Sequence:CCGGAGAATGATCTTCCTTGGGAATCTCGAGATTCCCAAGGAAGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325736    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_134105.2-479s21c1
Sequence:CCGGCCTGCAATAGAAAGGACCTAACTCGAGTTAGGTCCTTTCTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125960    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-367s1c1
Sequence:CCGGGTCTCTCAATCACATCTTCATCTCGAGATGAAGATGTGATTGAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_134105.1-504s1c1
Sequence:CCGGCCTGCAATAGAAAGGACCTAACTCGAGTTAGGTCCTTTCTATTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-544s1c1
Sequence:CCGGCCTCCCTATCACCCTCCCGAACTCGAGTTCGGGAGGGTGATAGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-572s1c1
Sequence:CCGGCGGTTCATTCTGCATCACTCACTCGAGTGAGTGATGCAGAATGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134105.1-447s1c1
Sequence:CCGGAGAATGATCTTCCTTGGGAATCTCGAGATTCCCAAGGAAGATCATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks