EMAIL THIS PAGE TO A FRIEND

TXNDC12

thioredoxin domain containing 12 (endoplasmic reticulum)

Synonyms: AG1 AGR1 ERP16 ERP18 ERP19 PDIA16 TLP19 hAG-1 hTLP19
UniProtKB ID: O95881, B3KQS0, Q5T1T4, Q96H50
Gene ID:
Human(51060) Summary: This gene encodes a member of the thioredoxin superfamily. Members of this family are characterized by a conserved active motif called the thioredoxin fold that catalyzes disulfide bond formation and isomerization. This protein localizes to the endoplasmic reticulum and has a single atypical active motif. The encoded protein is mainly involved in catalyzing native disulfide bond formation and displays activity similar to protein-disulfide isomerases. This protein may play a role in defense against endoplasmic reticulum stress. Alternate splicing results in both coding and non-coding variants. [provided by RefSeq, Mar 2012]
Mouse(66073) thioredoxin domain containing 12 (endoplasmic reticulum)
Rat(298370) thioredoxin domain containing 12 (endoplasmic reticulum)
domestic guinea pig(100728766) thioredoxin domain containing 12 (endoplasmic reticulum)
naked mole-rat(101714855) thioredoxin domain containing 12 (endoplasmic reticulum)
cow(506991) thioredoxin domain containing 12 (endoplasmic reticulum)
sheep(101113445) thioredoxin domain containing 12 (endoplasmic reticulum)
Zebrafish(324900) thioredoxin domain containing 12 (endoplasmic reticulum)
chicken(772208) thioredoxin domain containing 12 (endoplasmic reticulum)
domestic cat(101089631) thioredoxin domain containing 12 (endoplasmic reticulum)
dog(609843) thioredoxin domain containing 12 (endoplasmic reticulum)
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025334 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025334 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025334 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_015913 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015913 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015913 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU077151 MISSION® esiRNA esiRNA targeting mouse Txndc12 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015913 Rosetta Predictions human pricing
XM_001067457 Rosetta Predictions rat pricing
XM_216482 Rosetta Predictions rat pricing
NM_025334 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015913 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00201857 predicted 814
2 SASI_Hs01_00201858 predicted 466
3 SASI_Hs01_00201859 predicted 980
4 SASI_Hs01_00201860 predicted 489
5 SASI_Hs01_00201861 predicted 894
6 SASI_Hs01_00201862 predicted 847
7 SASI_Hs01_00201863 predicted 932
8 SASI_Hs01_00201864 predicted 568
9 SASI_Hs01_00201865 predicted 600
10 SASI_Hs02_00348525 predicted 646
11 SASI_Hs01_00201866 predicted 770
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001067457 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00321025 predicted 1046
2 SASI_Rn02_00321026 predicted 764
3 SASI_Rn02_00321027 predicted 636
4 SASI_Rn02_00321028 predicted 209
5 SASI_Rn02_00321029 predicted 981
6 SASI_Rn02_00321030 predicted 1032
7 SASI_Rn02_00321031 predicted 827
8 SASI_Rn02_00321032 predicted 821
9 SASI_Rn02_00321033 predicted 586
10 SASI_Rn02_00321034 predicted 432
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216482 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376610 predicted 1045
2 SASI_Rn02_00376611 predicted 767
3 SASI_Rn02_00376612 predicted 633
4 SASI_Rn02_00376613 predicted 215
5 SASI_Rn02_00376614 predicted 984
6 SASI_Rn02_00376615 predicted 1030
7 SASI_Rn02_00376616 predicted 825
8 SASI_Rn02_00376617 predicted 827
9 SASI_Rn02_00376618 predicted 591
10 SASI_Rn02_00376619 predicted 434
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025334 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032484 predicted 948
2 SASI_Mm01_00032485 predicted 863
3 SASI_Mm02_00327987 predicted 602
4 SASI_Mm01_00032486 predicted 586
5 SASI_Mm01_00032487 predicted 457
6 SASI_Mm01_00032489 predicted 299
7 SASI_Mm01_00032490 predicted 247
8 SASI_Mm01_00032491 predicted 847
9 SASI_Mm02_00327988 predicted 300
10 SASI_Mm02_00327989 predicted 575
11 SASI_Mm01_00032483 predicted 680
12 SASI_Mm01_00032488 predicted 584
13 SASI_Mm01_00032492 predicted 485
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025334
VALIDATED
TXNDC12 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 12 (endoplasmic reticulum)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-862s1c1
Sequence:CCGGCCATGTCAGTATTTGAGTCTTCTCGAGAAGACTCAAATACTGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-489s1c1
Sequence:CCGGGCTACAAGTATTTCTACGTCACTCGAGTGACGTAGAAATACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-506s1c1
Sequence:CCGGGTCAGTGCTGAGCAAGTTGTTCTCGAGAACAACTTGCTCAGCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-251s1c1
Sequence:CCGGCTGATGGTGATCATCCATAAACTCGAGTTTATGGATGATCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-454s1c1
Sequence:CCGGGCGTCCTGAAATCATCAATGACTCGAGTCATTGATGATTTCAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-280s21c1
Sequence:CCGGTGGAGCCTGCAAAGCTTTAAACTCGAGTTTAAAGCTTTGCAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-328s21c1
Sequence:CCGGTTCAGAACTGTCCCATAATTTCTCGAGAAATTATGGGACAGTTCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-818s21c1
Sequence:CCGGATGAAACTCTTTGATACTAACCTCGAGGTTAGTATCAAAGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025334.3-251s21c1
Sequence:CCGGCTGATGGTGATCATCCATAAACTCGAGTTTATGGATGATCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-628s21c1
Sequence:CCGGCAGCAGAGAGCGAATCCTAAACTCGAGTTTAGGATTCGCTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-411s21c1
Sequence:CCGGGTTATATCCCACGCATCCTTTCTCGAGAAAGGATGCGTGGGATATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025334
VALIDATED
TXNDC12 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 12 (endoplasmic reticulum)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-862s1c1
Sequence:CCGGCCATGTCAGTATTTGAGTCTTCTCGAGAAGACTCAAATACTGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-489s1c1
Sequence:CCGGGCTACAAGTATTTCTACGTCACTCGAGTGACGTAGAAATACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-506s1c1
Sequence:CCGGGTCAGTGCTGAGCAAGTTGTTCTCGAGAACAACTTGCTCAGCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-251s1c1
Sequence:CCGGCTGATGGTGATCATCCATAAACTCGAGTTTATGGATGATCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-454s1c1
Sequence:CCGGGCGTCCTGAAATCATCAATGACTCGAGTCATTGATGATTTCAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-280s21c1
Sequence:CCGGTGGAGCCTGCAAAGCTTTAAACTCGAGTTTAAAGCTTTGCAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-328s21c1
Sequence:CCGGTTCAGAACTGTCCCATAATTTCTCGAGAAATTATGGGACAGTTCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-818s21c1
Sequence:CCGGATGAAACTCTTTGATACTAACCTCGAGGTTAGTATCAAAGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025334.3-251s21c1
Sequence:CCGGCTGATGGTGATCATCCATAAACTCGAGTTTATGGATGATCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-628s21c1
Sequence:CCGGCAGCAGAGAGCGAATCCTAAACTCGAGTTTAGGATTCGCTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-411s21c1
Sequence:CCGGGTTATATCCCACGCATCCTTTCTCGAGAAAGGATGCGTGGGATATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025334
VALIDATED
TXNDC12 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 12 (endoplasmic reticulum)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120922    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-862s1c1
Sequence:CCGGCCATGTCAGTATTTGAGTCTTCTCGAGAAGACTCAAATACTGACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120925    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-489s1c1
Sequence:CCGGGCTACAAGTATTTCTACGTCACTCGAGTGACGTAGAAATACTTGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-506s1c1
Sequence:CCGGGTCAGTGCTGAGCAAGTTGTTCTCGAGAACAACTTGCTCAGCACTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120924    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-251s1c1
Sequence:CCGGCTGATGGTGATCATCCATAAACTCGAGTTTATGGATGATCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120923    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025334.2-454s1c1
Sequence:CCGGGCGTCCTGAAATCATCAATGACTCGAGTCATTGATGATTTCAGGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329013    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-280s21c1
Sequence:CCGGTGGAGCCTGCAAAGCTTTAAACTCGAGTTTAAAGCTTTGCAGGCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329074    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-328s21c1
Sequence:CCGGTTCAGAACTGTCCCATAATTTCTCGAGAAATTATGGGACAGTTCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329073    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-818s21c1
Sequence:CCGGATGAAACTCTTTGATACTAACCTCGAGGTTAGTATCAAAGAGTTTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025334.3-251s21c1
Sequence:CCGGCTGATGGTGATCATCCATAAACTCGAGTTTATGGATGATCACCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375213    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-628s21c1
Sequence:CCGGCAGCAGAGAGCGAATCCTAAACTCGAGTTTAGGATTCGCTCTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375278    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025334.3-411s21c1
Sequence:CCGGGTTATATCCCACGCATCCTTTCTCGAGAAAGGATGCGTGGGATATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015913
VALIDATED
TXNDC12 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 12 (endoplasmic reticulum)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-334s1c1
Sequence:CCGGCTCCTCGTCATCTCTTCTGATCTCGAGATCAGAAGAGATGACGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-608s1c1
Sequence:CCGGGTTATATTCCACGAATCCTTTCTCGAGAAAGGATTCGTGGAATATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-763s1c1
Sequence:CCGGGCCTTCAGAAAGAAACATCTTCTCGAGAAGATGTTTCTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-447s1c1
Sequence:CCGGCCTGATGGTGATTATTCATAACTCGAGTTATGAATAATCACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-485s1c1
Sequence:CCGGGCAAAGCTCTAAAGCCCAAATCTCGAGATTTGGGCTTTAGAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015913.2-1030s21c1
Sequence:CCGGATGTCAACTTGTCATTGAATGCTCGAGCATTCAATGACAAGTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015913.2-650s21c1
Sequence:CCGGTGCATCCTGAAATCATCAATGCTCGAGCATTGATGATTTCAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015913
VALIDATED
TXNDC12 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 12 (endoplasmic reticulum)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-334s1c1
Sequence:CCGGCTCCTCGTCATCTCTTCTGATCTCGAGATCAGAAGAGATGACGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-608s1c1
Sequence:CCGGGTTATATTCCACGAATCCTTTCTCGAGAAAGGATTCGTGGAATATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-763s1c1
Sequence:CCGGGCCTTCAGAAAGAAACATCTTCTCGAGAAGATGTTTCTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-447s1c1
Sequence:CCGGCCTGATGGTGATTATTCATAACTCGAGTTATGAATAATCACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-485s1c1
Sequence:CCGGGCAAAGCTCTAAAGCCCAAATCTCGAGATTTGGGCTTTAGAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015913.2-1030s21c1
Sequence:CCGGATGTCAACTTGTCATTGAATGCTCGAGCATTCAATGACAAGTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015913.2-650s21c1
Sequence:CCGGTGCATCCTGAAATCATCAATGCTCGAGCATTGATGATTTCAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015913
VALIDATED
TXNDC12 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 12 (endoplasmic reticulum)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-334s1c1
Sequence:CCGGCTCCTCGTCATCTCTTCTGATCTCGAGATCAGAAGAGATGACGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064392    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-608s1c1
Sequence:CCGGGTTATATTCCACGAATCCTTTCTCGAGAAAGGATTCGTGGAATATAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064388    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-763s1c1
Sequence:CCGGGCCTTCAGAAAGAAACATCTTCTCGAGAAGATGTTTCTTTCTGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064390    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-447s1c1
Sequence:CCGGCCTGATGGTGATTATTCATAACTCGAGTTATGAATAATCACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064389    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_015913.2-485s1c1
Sequence:CCGGGCAAAGCTCTAAAGCCCAAATCTCGAGATTTGGGCTTTAGAGCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425370    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015913.2-1030s21c1
Sequence:CCGGATGTCAACTTGTCATTGAATGCTCGAGCATTCAATGACAAGTTGACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416816    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015913.2-650s21c1
Sequence:CCGGTGCATCCTGAAATCATCAATGCTCGAGCATTGATGATTTCAGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks