EMAIL THIS PAGE TO A FRIEND

TXNDC15

thioredoxin domain containing 15

Synonyms: C5orf14 UNQ335
UniProtKB ID: Q96J42, D3DQA9, Q96MT2, Q9H639
Gene ID:
Mouse(69672) thioredoxin domain containing 15
Rat(307180) thioredoxin domain containing 15
chicken(416310) thioredoxin domain containing 15
dog(609963) thioredoxin domain containing 15
domestic cat(101086694) thioredoxin domain containing 15
cow(523911) thioredoxin domain containing 15
sheep(100302358) thioredoxin domain containing 15
naked mole-rat(101710255) thioredoxin domain containing 15
domestic guinea pig(100715330) thioredoxin domain containing 15
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024715 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024715 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024715 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175150 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175150 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175150 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024715 Rosetta Predictions human pricing
NM_001024998 Rosetta Predictions rat pricing
NM_175150 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024715 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357172 predicted 1759
2 SASI_Hs01_00154311 predicted 1186
3 SASI_Hs01_00154312 predicted 1362
4 SASI_Hs02_00357173 predicted 1730
5 SASI_Hs01_00154313 predicted 1193
6 SASI_Hs01_00154314 predicted 1356
7 SASI_Hs02_00357174 predicted 1565
8 SASI_Hs02_00357175 predicted 1782
9 SASI_Hs01_00154315 predicted 1414
10 SASI_Hs01_00154316 predicted 1463
11 SASI_Hs01_00154317 predicted 1096
12 SASI_Hs01_00154318 predicted 830
13 SASI_Hs01_00154319 predicted 1099
14 SASI_Hs01_00154320 predicted 1073
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024998 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00107061 predicted 821
2 SASI_Rn01_00107062 predicted 551
3 SASI_Rn01_00107063 predicted 836
4 SASI_Rn01_00107064 predicted 765
5 SASI_Rn01_00107065 predicted 1182
6 SASI_Rn01_00107066 predicted 1275
7 SASI_Rn01_00107067 predicted 392
8 SASI_Rn01_00107069 predicted 1128
9 SASI_Rn01_00107070 predicted 636
10 SASI_Rn02_00202895 predicted 715
11 SASI_Rn01_00107068 predicted 616
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175150 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00109576 predicted 611
2 SASI_Mm01_00109577 predicted 1196
3 SASI_Mm01_00109578 predicted 1247
4 SASI_Mm01_00109579 predicted 1151
5 SASI_Mm01_00109580 predicted 1209
6 SASI_Mm01_00109581 predicted 668
7 SASI_Mm01_00109582 predicted 1167
8 SASI_Mm01_00109583 predicted 887
9 SASI_Mm02_00345789 predicted 683
10 SASI_Mm01_00109584 predicted 1042
11 SASI_Mm01_00109585 predicted 606
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024715
VALIDATED
TXNDC15 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 15
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1135s21c1
Sequence:CCGGCCCGACAGAGGACTCCAATAACTCGAGTTATTGGAGTCCTCTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1081s21c1
Sequence:CCGGTGACAGAGAAGAGGAGTATTACTCGAGTAATACTCCTCTTCTCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024715.3-1838s21c1
Sequence:CCGGTGAAACTTCAGGCAGATTAAACTCGAGTTTAATCTGCCTGAAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1431s21c1
Sequence:CCGGGCACCGTAGCTGTTCCTAATACTCGAGTATTAGGAACAGCTACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1516s1c1
Sequence:CCGGGCCAGATTTAATCATACAGATCTCGAGATCTGTATGATTAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1228s1c1
Sequence:CCGGGAGAGAAACATTACAGGATTACTCGAGTAATCCTGTAATGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1466s1c1
Sequence:CCGGGCACCGTAGCTGTTCCTAATACTCGAGTATTAGGAACAGCTACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024715.2-1615s1c1
Sequence:CCGGGCCGACCAAATAGGCCCTCTTCTCGAGAAGAGGGCCTATTTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-800s1c1
Sequence:CCGGCAGAGGAAAGTGGTCGCTTATCTCGAGATAAGCGACCACTTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024715
VALIDATED
TXNDC15 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 15
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1135s21c1
Sequence:CCGGCCCGACAGAGGACTCCAATAACTCGAGTTATTGGAGTCCTCTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1081s21c1
Sequence:CCGGTGACAGAGAAGAGGAGTATTACTCGAGTAATACTCCTCTTCTCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024715.3-1838s21c1
Sequence:CCGGTGAAACTTCAGGCAGATTAAACTCGAGTTTAATCTGCCTGAAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1431s21c1
Sequence:CCGGGCACCGTAGCTGTTCCTAATACTCGAGTATTAGGAACAGCTACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1516s1c1
Sequence:CCGGGCCAGATTTAATCATACAGATCTCGAGATCTGTATGATTAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1228s1c1
Sequence:CCGGGAGAGAAACATTACAGGATTACTCGAGTAATCCTGTAATGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1466s1c1
Sequence:CCGGGCACCGTAGCTGTTCCTAATACTCGAGTATTAGGAACAGCTACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024715.2-1615s1c1
Sequence:CCGGGCCGACCAAATAGGCCCTCTTCTCGAGAAGAGGGCCTATTTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-800s1c1
Sequence:CCGGCAGAGGAAAGTGGTCGCTTATCTCGAGATAAGCGACCACTTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024715
VALIDATED
TXNDC15 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 15
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296278    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1135s21c1
Sequence:CCGGCCCGACAGAGGACTCCAATAACTCGAGTTATTGGAGTCCTCTGTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296279    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1081s21c1
Sequence:CCGGTGACAGAGAAGAGGAGTATTACTCGAGTAATACTCCTCTTCTCTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296280    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024715.3-1838s21c1
Sequence:CCGGTGAAACTTCAGGCAGATTAAACTCGAGTTTAATCTGCCTGAAGTTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289657    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024715.3-1431s21c1
Sequence:CCGGGCACCGTAGCTGTTCCTAATACTCGAGTATTAGGAACAGCTACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064308    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1516s1c1
Sequence:CCGGGCCAGATTTAATCATACAGATCTCGAGATCTGTATGATTAAATCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064312    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1228s1c1
Sequence:CCGGGAGAGAAACATTACAGGATTACTCGAGTAATCCTGTAATGTTTCTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064309    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-1466s1c1
Sequence:CCGGGCACCGTAGCTGTTCCTAATACTCGAGTATTAGGAACAGCTACGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064311    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024715.2-1615s1c1
Sequence:CCGGGCCGACCAAATAGGCCCTCTTCTCGAGAAGAGGGCCTATTTGGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064310    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_024715.2-800s1c1
Sequence:CCGGCAGAGGAAAGTGGTCGCTTATCTCGAGATAAGCGACCACTTTCCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175150
VALIDATED
TXNDC15 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 15
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-1101s21c1
Sequence:CCGGACCATCCGCACTGAGAGTATTCTCGAGAATACTCTCAGTGCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175150.3-892s1c1
Sequence:CCGGCTAAACCAATGGCAAGGTTTACTCGAGTAAACCTTGCCATTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-505s21c1
Sequence:CCGGATCGGGAAGAGGAGTACTATGCTCGAGCATAGTACTCCTCTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-831s21c1
Sequence:CCGGAGCAGCCTTTCTACCAGATTTCTCGAGAAATCTGGTAGAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-1215s21c1
Sequence:CCGGTAGCATTACAGTCGCTAAATGCTCGAGCATTTAGCGACTGTAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-856s21c1
Sequence:CCGGCTGTAGCTGTCCCTAACATTTCTCGAGAAATGTTAGGGACAGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175150.3-1353s1c1
Sequence:CCGGCCACTAGAATTGACTGTTGTTCTCGAGAACAACAGTCAATTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175150
VALIDATED
TXNDC15 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 15
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-1101s21c1
Sequence:CCGGACCATCCGCACTGAGAGTATTCTCGAGAATACTCTCAGTGCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175150.3-892s1c1
Sequence:CCGGCTAAACCAATGGCAAGGTTTACTCGAGTAAACCTTGCCATTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-505s21c1
Sequence:CCGGATCGGGAAGAGGAGTACTATGCTCGAGCATAGTACTCCTCTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-831s21c1
Sequence:CCGGAGCAGCCTTTCTACCAGATTTCTCGAGAAATCTGGTAGAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-1215s21c1
Sequence:CCGGTAGCATTACAGTCGCTAAATGCTCGAGCATTTAGCGACTGTAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-856s21c1
Sequence:CCGGCTGTAGCTGTCCCTAACATTTCTCGAGAAATGTTAGGGACAGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175150.3-1353s1c1
Sequence:CCGGCCACTAGAATTGACTGTTGTTCTCGAGAACAACAGTCAATTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175150
VALIDATED
TXNDC15 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 15
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-1101s21c1
Sequence:CCGGACCATCCGCACTGAGAGTATTCTCGAGAATACTCTCAGTGCGGATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_175150.3-892s1c1
Sequence:CCGGCTAAACCAATGGCAAGGTTTACTCGAGTAAACCTTGCCATTGGTTTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246706    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-505s21c1
Sequence:CCGGATCGGGAAGAGGAGTACTATGCTCGAGCATAGTACTCCTCTTCCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246705    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-831s21c1
Sequence:CCGGAGCAGCCTTTCTACCAGATTTCTCGAGAAATCTGGTAGAAAGGCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246703    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-1215s21c1
Sequence:CCGGTAGCATTACAGTCGCTAAATGCTCGAGCATTTAGCGACTGTAATGCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257529    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_175150.3-856s21c1
Sequence:CCGGCTGTAGCTGTCCCTAACATTTCTCGAGAAATGTTAGGGACAGCTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191706    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_175150.3-1353s1c1
Sequence:CCGGCCACTAGAATTGACTGTTGTTCTCGAGAACAACAGTCAATTCTAGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks