EMAIL THIS PAGE TO A FRIEND

TXNDC16

thioredoxin domain containing 16

Synonyms: ERp90 KIAA1344
UniProtKB ID: Q9P2K2, A5PKW9, A7E260, A7MD07, B9EH67, Q9H9W7
Gene ID:
Mouse(70561) thioredoxin domain containing 16
Rat(361025) thioredoxin domain containing 16
domestic guinea pig(100731661) thioredoxin domain containing 16
naked mole-rat(101717343) thioredoxin domain containing 16
Domestic Rabbit(100347925) thioredoxin domain containing 16
cow(536075) thioredoxin domain containing 16
sheep(101116910) thioredoxin domain containing 16
chicken(423584) thioredoxin domain containing 16
Horse(100049832) thioredoxin domain containing 16
domestic cat(101098545) thioredoxin domain containing 16
dog(480323) thioredoxin domain containing 16
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2108249 Anti-TXNDC16 antibody produced in rabbit affinity isolated antibody canine, mouse, human, rat, horse, rabbit, guinea pig, bovine
western blot pricing
HPA002543 Anti-TXNDC16 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
SAB2102614 Anti-TXNDC16 antibody produced in rabbit affinity isolated antibody, lyophilized powder human, horse, mouse, rat, bovine, rabbit, canine
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172597 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172597 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172597 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-XM_051699 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_051699 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_051699 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_020784 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020784 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020784 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU045921 MISSION® esiRNA esiRNA human TXNDC16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020784 Rosetta Predictions human pricing
XM_001072487 Rosetta Predictions rat pricing
XM_341301 Rosetta Predictions rat pricing
NM_172597 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020784 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00139435 predicted 1937
2 SASI_Hs01_00139436 predicted 1094
3 SASI_Hs02_00353940 predicted 2148
4 SASI_Hs01_00139437 predicted 549
5 SASI_Hs01_00139438 predicted 1944
6 SASI_Hs01_00139439 predicted 1026
7 SASI_Hs01_00139440 predicted 1020
8 SASI_Hs01_00139441 predicted 1700
9 SASI_Hs01_00139442 predicted 2189
10 SASI_Hs02_00353941 predicted 1358
11 SASI_Hs01_00139433 predicted 1550
12 SASI_Hs01_00139434 predicted 1078
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001072487 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00339373 predicted 1267
2 SASI_Rn02_00339374 predicted 604
3 SASI_Rn02_00339375 predicted 655
4 SASI_Rn02_00339376 predicted 863
5 SASI_Rn02_00339377 predicted 467
6 SASI_Rn02_00339378 predicted 1323
7 SASI_Rn02_00339379 predicted 1603
8 SASI_Rn02_00339380 predicted 278
9 SASI_Rn02_00339381 predicted 870
10 SASI_Rn02_00339382 predicted 2010
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341301 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392688 predicted 602
2 SASI_Rn02_00392689 predicted 663
3 SASI_Rn02_00392690 predicted 861
4 SASI_Rn02_00392691 predicted 467
5 SASI_Rn02_00392692 predicted 1315
6 SASI_Rn02_00392693 predicted 1599
7 SASI_Rn02_00392694 predicted 270
8 SASI_Rn02_00392695 predicted 871
9 SASI_Rn02_00392696 predicted 2265
10 SASI_Rn02_00392697 predicted 2011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172597 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00089811 predicted 596
2 SASI_Mm01_00089812 predicted 1757
3 SASI_Mm01_00089813 predicted 477
4 SASI_Mm01_00089814 predicted 460
5 SASI_Mm01_00089815 predicted 1772
6 SASI_Mm01_00089816 predicted 1997
7 SASI_Mm02_00344295 predicted 611
8 SASI_Mm01_00089817 predicted 1584
9 SASI_Mm01_00089818 predicted 1653
10 SASI_Mm01_00089819 predicted 2212
11 SASI_Mm01_00089820 predicted 2123
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172597
VALIDATED
TXNDC16 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000200368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-3448s1c1
Sequence:CCGGGCAACCTTGTAGTAGCCTGTACTCGAGTACAGGCTACTACAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-1595s1c1
Sequence:CCGGCCTATATTGATGTGGCAATTACTCGAGTAATTGCCACATCAATATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-2115s1c1
Sequence:CCGGCATGGCTCAGATACTAGCAAACTCGAGTTTGCTAGTATCTGAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-1104s1c1
Sequence:CCGGCGTTCATCTACAACTAGGATTCTCGAGAATCCTAGTTGTAGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-3151s1c1
Sequence:CCGGCCTGTGCATTTGAATCAAATTCTCGAGAATTTGATTCAAATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172597
VALIDATED
TXNDC16 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000200368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-3448s1c1
Sequence:CCGGGCAACCTTGTAGTAGCCTGTACTCGAGTACAGGCTACTACAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-1595s1c1
Sequence:CCGGCCTATATTGATGTGGCAATTACTCGAGTAATTGCCACATCAATATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-2115s1c1
Sequence:CCGGCATGGCTCAGATACTAGCAAACTCGAGTTTGCTAGTATCTGAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-1104s1c1
Sequence:CCGGCGTTCATCTACAACTAGGATTCTCGAGAATCCTAGTTGTAGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-3151s1c1
Sequence:CCGGCCTGTGCATTTGAATCAAATTCTCGAGAATTTGATTCAAATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172597
VALIDATED
TXNDC16 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000200368    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.62 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-3448s1c1
Sequence:CCGGGCAACCTTGTAGTAGCCTGTACTCGAGTACAGGCTACTACAAGGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-1595s1c1
Sequence:CCGGCCTATATTGATGTGGCAATTACTCGAGTAATTGCCACATCAATATAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198766    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-2115s1c1
Sequence:CCGGCATGGCTCAGATACTAGCAAACTCGAGTTTGCTAGTATCTGAGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-1104s1c1
Sequence:CCGGCGTTCATCTACAACTAGGATTCTCGAGAATCCTAGTTGTAGATGAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176731    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_172597.1-3151s1c1
Sequence:CCGGCCTGTGCATTTGAATCAAATTCTCGAGAATTTGATTCAAATGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_051699
VALIDATED
TXNDC16 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 16
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051699.4-2340s1c1
Sequence:CCGGGCACTGTAAATCCTCAGTATACTCGAGTATACTGAGGATTTACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-2795s1c1
Sequence:CCGGCCGATTGAAACTCTGAGAATACTCGAGTATTCTCAGAGTTTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-1900s1c1
Sequence:CCGGCCAGCTCAACAGGATTTCATACTCGAGTATGAAATCCTGTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051699.4-1707s1c1
Sequence:CCGGCCTATATTGATGTGGCAGTTACTCGAGTAACTGCCACATCAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-662s1c1
Sequence:CCGGGCCAAGGTTAATTGTGTCAAACTCGAGTTTGACACAATTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_051699
VALIDATED
TXNDC16 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 16
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051699.4-2340s1c1
Sequence:CCGGGCACTGTAAATCCTCAGTATACTCGAGTATACTGAGGATTTACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-2795s1c1
Sequence:CCGGCCGATTGAAACTCTGAGAATACTCGAGTATTCTCAGAGTTTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-1900s1c1
Sequence:CCGGCCAGCTCAACAGGATTTCATACTCGAGTATGAAATCCTGTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051699.4-1707s1c1
Sequence:CCGGCCTATATTGATGTGGCAGTTACTCGAGTAACTGCCACATCAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-662s1c1
Sequence:CCGGGCCAAGGTTAATTGTGTCAAACTCGAGTTTGACACAATTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_051699
VALIDATED
TXNDC16 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 16
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064168    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051699.4-2340s1c1
Sequence:CCGGGCACTGTAAATCCTCAGTATACTCGAGTATACTGAGGATTTACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064171    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-2795s1c1
Sequence:CCGGCCGATTGAAACTCTGAGAATACTCGAGTATTCTCAGAGTTTCAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-1900s1c1
Sequence:CCGGCCAGCTCAACAGGATTTCATACTCGAGTATGAAATCCTGTTGAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064170    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_051699.4-1707s1c1
Sequence:CCGGCCTATATTGATGTGGCAGTTACTCGAGTAACTGCCACATCAATATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064169    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:XM_051699.4-662s1c1
Sequence:CCGGGCCAAGGTTAATTGTGTCAAACTCGAGTTTGACACAATTAACCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020784
TXNDC16 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 16
Human
2 Products Total
TRC Number Price Set Price (2)? Select
TRCN0000378753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020784.2-3252s21c1
Sequence:CCGGTACTTCCGAGTAGCCATATTTCTCGAGAAATATGGCTACTCGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020784.2-2029s21c1
Sequence:CCGGTGTCAGTATTGGGACTATTTACTCGAGTAAATAGTCCCAATACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020784
TXNDC16 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 16
Human
2 Products Total
TRC Number Vector Price Set Price (2)? Select
TRCN0000378753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020784.2-3252s21c1
Sequence:CCGGTACTTCCGAGTAGCCATATTTCTCGAGAAATATGGCTACTCGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020784.2-2029s21c1
Sequence:CCGGTGTCAGTATTGGGACTATTTACTCGAGTAAATAGTCCCAATACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020784
TXNDC16 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 16
Human
2 Products Total
TRC Number Volume Titer Vector Price Set Price (2)? Select
TRCN0000378753    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_020784.2-3252s21c1
Sequence:CCGGTACTTCCGAGTAGCCATATTTCTCGAGAAATATGGCTACTCGGAAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372682    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020784.2-2029s21c1
Sequence:CCGGTGTCAGTATTGGGACTATTTACTCGAGTAAATAGTCCCAATACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks