EMAIL THIS PAGE TO A FRIEND

TXNDC17

thioredoxin domain containing 17

Synonyms: TRP14 TXNL5
UniProtKB ID: Q9BRA2, A8K7E8
Gene ID:
Mouse(52700) thioredoxin domain containing 17
Rat(287474) thioredoxin domain containing 17
Zebrafish(445062) thioredoxin domain containing 17
chicken(417680) thioredoxin domain containing 17
cow(404159) thioredoxin domain containing 17
sheep(100302359) thioredoxin domain containing 17
naked mole-rat(101705710) thioredoxin domain containing 17
domestic guinea pig(100724194) thioredoxin domain containing 17
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA022931 Anti-TXNDC17 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032731 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032731 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032731 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026559 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026559 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026559 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032731 Rosetta Predictions human pricing
NM_001105805 Rosetta Predictions rat pricing
NM_026559 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032731 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00360264 predicted 700
2 SASI_Hs01_00140170 predicted 400
3 SASI_Hs02_00360265 predicted 771
4 SASI_Hs02_00360266 predicted 257
5 SASI_Hs02_00360267 predicted 524
6 SASI_Hs02_00360268 predicted 707
7 SASI_Hs01_00140171 predicted 345
8 SASI_Hs01_00140174 predicted 364
9 SASI_Hs02_00360269 predicted 754
10 SASI_Hs02_00360270 predicted 616
11 SASI_Hs01_00140167 predicted 466
12 SASI_Hs01_00140168 predicted 427
13 SASI_Hs01_00140169 predicted 419
14 SASI_Hs01_00140172 predicted 484
15 SASI_Hs01_00140173 predicted 354
16 SASI_Hs01_00140175 predicted 221
17 SASI_Hs01_00140176 predicted 403
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105805 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212706 predicted 940
2 SASI_Rn02_00212707 predicted 924
3 SASI_Rn02_00212708 predicted 867
4 SASI_Rn02_00212709 predicted 879
5 SASI_Rn02_00212710 predicted 856
6 SASI_Rn02_00212711 predicted 295
7 SASI_Rn02_00212712 predicted 304
8 SASI_Rn02_00212713 predicted 708
9 SASI_Rn02_00212714 predicted 692
10 SASI_Rn02_00212715 predicted 280
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026559 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144075 predicted 661
2 SASI_Mm01_00144076 predicted 425
3 SASI_Mm01_00144077 predicted 707
4 SASI_Mm01_00144078 predicted 835
5 SASI_Mm01_00144079 predicted 236
6 SASI_Mm01_00144080 predicted 657
7 SASI_Mm01_00144081 predicted 691
8 SASI_Mm01_00144082 predicted 252
9 SASI_Mm01_00144083 predicted 819
10 SASI_Mm01_00144084 predicted 733
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032731
VALIDATED
TXNDC17 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 17
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000433305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032731.3-321s21c1
Sequence:CCGGTGCAGGCTGAACCAGTCGTACCTCGAGGTACGACTGGTTCAGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032731.3-978s21c1
Sequence:CCGGTAATCTAGCCTCTGCTTAATTCTCGAGAATTAAGCAGAGGCTAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-160s1c1
Sequence:CCGGCGCCTACTTTACGGGTTCTAACTCGAGTTAGAACCCGTAAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-298s1c1
Sequence:CCGGGCCTTATTGGAAAGATCCAAACTCGAGTTTGGATCTTTCCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032731.2-269s1c1
Sequence:CCGGGTGTTCATCTACTGCCAAGTACTCGAGTACTTGGCAGTAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-357s1c1
Sequence:CCGGCTACACTACTTAAGTATGGAACTCGAGTTCCATACTTAAGTAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-246s1c1
Sequence:CCGGTGAAGCACATTAGTGAAGGATCTCGAGATCCTTCACTAATGTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032731
VALIDATED
TXNDC17 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 17
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000433305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032731.3-321s21c1
Sequence:CCGGTGCAGGCTGAACCAGTCGTACCTCGAGGTACGACTGGTTCAGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032731.3-978s21c1
Sequence:CCGGTAATCTAGCCTCTGCTTAATTCTCGAGAATTAAGCAGAGGCTAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-160s1c1
Sequence:CCGGCGCCTACTTTACGGGTTCTAACTCGAGTTAGAACCCGTAAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-298s1c1
Sequence:CCGGGCCTTATTGGAAAGATCCAAACTCGAGTTTGGATCTTTCCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032731.2-269s1c1
Sequence:CCGGGTGTTCATCTACTGCCAAGTACTCGAGTACTTGGCAGTAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-357s1c1
Sequence:CCGGCTACACTACTTAAGTATGGAACTCGAGTTCCATACTTAAGTAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-246s1c1
Sequence:CCGGTGAAGCACATTAGTGAAGGATCTCGAGATCCTTCACTAATGTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032731
VALIDATED
TXNDC17 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 17
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000433305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_032731.3-321s21c1
Sequence:CCGGTGCAGGCTGAACCAGTCGTACCTCGAGGTACGACTGGTTCAGCCTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414293    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_032731.3-978s21c1
Sequence:CCGGTAATCTAGCCTCTGCTTAATTCTCGAGAATTAAGCAGAGGCTAGATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064403    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-160s1c1
Sequence:CCGGCGCCTACTTTACGGGTTCTAACTCGAGTTAGAACCCGTAAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064404    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-298s1c1
Sequence:CCGGGCCTTATTGGAAAGATCCAAACTCGAGTTTGGATCTTTCCAATAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064405    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032731.2-269s1c1
Sequence:CCGGGTGTTCATCTACTGCCAAGTACTCGAGTACTTGGCAGTAGATGAACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064406    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-357s1c1
Sequence:CCGGCTACACTACTTAAGTATGGAACTCGAGTTCCATACTTAAGTAGTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064407    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_032731.2-246s1c1
Sequence:CCGGTGAAGCACATTAGTGAAGGATCTCGAGATCCTTCACTAATGTGCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026559
VALIDATED
TXNDC17 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 17
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000334879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026559.3-154s21c1
Sequence:CCGGCGCCTACTTCAGCGGTTCTAACTCGAGTTAGAACCGCTGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000334880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-344s21c1
Sequence:CCGGGCAGTGCCTACACTACTTAAACTCGAGTTTAAGTAGTGTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-296s21c1
Sequence:CCGGTACTGGAAAGACCCAAATAATCTCGAGATTATTTGGGTCTTTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-132s21c1
Sequence:CCGGAGCATGAGGGCAAGACCATTTCTCGAGAAATGGTCTTGCCCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000376977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026559.3-427s21c1
Sequence:CCGGCTTCTCTGAAGATTAAGATTTCTCGAGAAATCTTAATCTTCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026559.3-665s21c1
Sequence:CCGGGCCACATTATTGCTTTGAATTCTCGAGAATTCAAAGCAATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-665s1c1
Sequence:CCGGGCCACATTATTGCTTTGAATTCTCGAGAATTCAAAGCAATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026559.2-343s1c1
Sequence:CCGGCGCAGTGCCTACACTACTTAACTCGAGTTAAGTAGTGTAGGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026559.2-344s1c1
Sequence:CCGGGCAGTGCCTACACTACTTAAACTCGAGTTTAAGTAGTGTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-359s1c1
Sequence:CCGGCTTAAATATGGAACACCTCAACTCGAGTTGAGGTGTTCCATATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-154s1c1
Sequence:CCGGCGCCTACTTCAGCGGTTCTAACTCGAGTTAGAACCGCTGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026559
VALIDATED
TXNDC17 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 17
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000334879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026559.3-154s21c1
Sequence:CCGGCGCCTACTTCAGCGGTTCTAACTCGAGTTAGAACCGCTGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000334880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-344s21c1
Sequence:CCGGGCAGTGCCTACACTACTTAAACTCGAGTTTAAGTAGTGTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-296s21c1
Sequence:CCGGTACTGGAAAGACCCAAATAATCTCGAGATTATTTGGGTCTTTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-132s21c1
Sequence:CCGGAGCATGAGGGCAAGACCATTTCTCGAGAAATGGTCTTGCCCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000376977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026559.3-427s21c1
Sequence:CCGGCTTCTCTGAAGATTAAGATTTCTCGAGAAATCTTAATCTTCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026559.3-665s21c1
Sequence:CCGGGCCACATTATTGCTTTGAATTCTCGAGAATTCAAAGCAATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-665s1c1
Sequence:CCGGGCCACATTATTGCTTTGAATTCTCGAGAATTCAAAGCAATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026559.2-343s1c1
Sequence:CCGGCGCAGTGCCTACACTACTTAACTCGAGTTAAGTAGTGTAGGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026559.2-344s1c1
Sequence:CCGGGCAGTGCCTACACTACTTAAACTCGAGTTTAAGTAGTGTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-359s1c1
Sequence:CCGGCTTAAATATGGAACACCTCAACTCGAGTTGAGGTGTTCCATATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-154s1c1
Sequence:CCGGCGCCTACTTCAGCGGTTCTAACTCGAGTTAGAACCGCTGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026559
VALIDATED
TXNDC17 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 17
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000334879    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026559.3-154s21c1
Sequence:CCGGCGCCTACTTCAGCGGTTCTAACTCGAGTTAGAACCGCTGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000334880    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-344s21c1
Sequence:CCGGGCAGTGCCTACACTACTTAAACTCGAGTTTAAGTAGTGTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348442    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-296s21c1
Sequence:CCGGTACTGGAAAGACCCAAATAATCTCGAGATTATTTGGGTCTTTCCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_026559.3-132s21c1
Sequence:CCGGAGCATGAGGGCAAGACCATTTCTCGAGAAATGGTCTTGCCCTCATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000376977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026559.3-427s21c1
Sequence:CCGGCTTCTCTGAAGATTAAGATTTCTCGAGAAATCTTAATCTTCAGAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363826    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026559.3-665s21c1
Sequence:CCGGGCCACATTATTGCTTTGAATTCTCGAGAATTCAAAGCAATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-665s1c1
Sequence:CCGGGCCACATTATTGCTTTGAATTCTCGAGAATTCAAAGCAATAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099221    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026559.2-343s1c1
Sequence:CCGGCGCAGTGCCTACACTACTTAACTCGAGTTAAGTAGTGTAGGCACTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099222    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026559.2-344s1c1
Sequence:CCGGGCAGTGCCTACACTACTTAAACTCGAGTTTAAGTAGTGTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-359s1c1
Sequence:CCGGCTTAAATATGGAACACCTCAACTCGAGTTGAGGTGTTCCATATTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026559.2-154s1c1
Sequence:CCGGCGCCTACTTCAGCGGTTCTAACTCGAGTTAGAACCGCTGAAGTAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks