EMAIL THIS PAGE TO A FRIEND

TXNDC2

thioredoxin domain containing 2 (spermatozoa)

Synonyms: SPTRX SPTRX1
UniProtKB ID: Q86VQ3, Q8N7U4, Q96RX3, Q9H0L8
Gene ID:
Mouse(213272) thioredoxin domain containing 2 (spermatozoa)
Rat(316777) thioredoxin domain containing 2 (spermatozoa)
domestic guinea pig(100735435) thioredoxin domain containing 2 (spermatozoa)
naked mole-rat(101718706) thioredoxin domain containing 2 (spermatozoa)
cow(101906194) thioredoxin domain containing 2 (spermatozoa)
sheep(101104448) thioredoxin domain containing 2 (spermatozoa)
dog(490552) thioredoxin domain containing 2 (spermatozoa)
domestic cat(101100601) thioredoxin domain containing 2 (spermatozoa)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032243 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032243 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032243 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_153519 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153519 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153519 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098529 Rosetta Predictions human pricing
NM_001098530 Rosetta Predictions human pricing
NM_032243 Rosetta Predictions human pricing
NM_001005559 Rosetta Predictions rat pricing
NM_153519 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319330 predicted 1564
2 SASI_Hs02_00319331 predicted 1748
3 SASI_Hs02_00319332 predicted 1604
4 SASI_Hs02_00319333 predicted 1677
5 SASI_Hs02_00319334 predicted 1812
6 SASI_Hs02_00319335 predicted 1741
7 SASI_Hs02_00319336 predicted 1103
8 SASI_Hs02_00319337 predicted 1640
9 SASI_Hs02_00319338 predicted 1730
10 SASI_Hs02_00319339 predicted 1746
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098530 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00319340 predicted 1100
2 SASI_Hs02_00319341 predicted 1281
3 SASI_Hs02_00319342 predicted 1144
4 SASI_Hs02_00319343 predicted 1210
5 SASI_Hs02_00319344 predicted 1351
6 SASI_Hs02_00319345 predicted 1278
7 SASI_Hs02_00319346 predicted 641
8 SASI_Hs02_00319347 predicted 1170
9 SASI_Hs02_00319348 predicted 1265
10 SASI_Hs02_00319349 predicted 1275
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032243 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244335 predicted 1361
2 SASI_Hs01_00244336 predicted 1545
3 SASI_Hs01_00244337 predicted 1396
4 SASI_Hs01_00244338 predicted 1468
5 SASI_Hs01_00244339 predicted 1608
6 SASI_Hs01_00244340 predicted 1535
7 SASI_Hs01_00244341 predicted 908
8 SASI_Hs01_00244342 predicted 1436
9 SASI_Hs02_00359553 predicted 1525
10 SASI_Hs02_00359554 predicted 1538
11 SASI_Hs01_00244334 predicted 433
12 SASI_Hs01_00244343 predicted 438
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005559 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00045720 predicted 369
2 SASI_Rn01_00045721 predicted 1346
3 SASI_Rn01_00045723 predicted 981
4 SASI_Rn01_00045724 predicted 599
5 SASI_Rn01_00045725 predicted 239
6 SASI_Rn01_00045726 predicted 965
7 SASI_Rn02_00198421 predicted 412
8 SASI_Rn01_00045728 predicted 452
9 SASI_Rn01_00045729 predicted 1237
10 SASI_Rn02_00198422 predicted 575
11 SASI_Rn01_00045722 predicted 1376
12 SASI_Rn01_00045727 predicted 749
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153519 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111781 predicted 636
2 SASI_Mm01_00111782 predicted 1189
3 SASI_Mm01_00111783 predicted 553
4 SASI_Mm01_00111784 predicted 326
5 SASI_Mm01_00111785 predicted 1281
6 SASI_Mm01_00111786 predicted 597
7 SASI_Mm01_00111787 predicted 1297
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032243
TXNDC2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 2 (spermatozoa)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000164408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1454s1c1
Sequence:CCGGCAAGGAGGGTGACATCCTAAACTCGAGTTTAGGATGTCACCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1652s1c1
Sequence:CCGGGAAGCATGAGGATGTGGTGTTCTCGAGAACACCACATCCTCATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-593s1c1
Sequence:CCGGCCAGCCCAAAGAGAGTAACATCTCGAGATGTTACTCTCTTTGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-535s1c1
Sequence:CCGGCAGAAGAAACCATCCAATCCACTCGAGTGGATTGGATGGTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1464s1c1
Sequence:CCGGGACATCCTAAAGCCTGAAGAACTCGAGTTCTTCAGGCTTTAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000162650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-482s1c1
Sequence:CCGGCAAGTCCTCAGAAGAAACCATCTCGAGATGGTTTCTTCTGAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1282s1c1
Sequence:CCGGGTGACATTCCCAAGTCTCCAACTCGAGTTGGAGACTTGGGAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000163980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1616s1c1
Sequence:CCGGCAGGACCATCAGACCATTCTTCTCGAGAAGAATGGTCTGATGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000164061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1541s1c1
Sequence:CCGGCTTTGAGGCATCACTGAAGGACTCGAGTCCTTCAGTGATGCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032243
TXNDC2 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 2 (spermatozoa)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000164408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1454s1c1
Sequence:CCGGCAAGGAGGGTGACATCCTAAACTCGAGTTTAGGATGTCACCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1652s1c1
Sequence:CCGGGAAGCATGAGGATGTGGTGTTCTCGAGAACACCACATCCTCATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-593s1c1
Sequence:CCGGCCAGCCCAAAGAGAGTAACATCTCGAGATGTTACTCTCTTTGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-535s1c1
Sequence:CCGGCAGAAGAAACCATCCAATCCACTCGAGTGGATTGGATGGTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1464s1c1
Sequence:CCGGGACATCCTAAAGCCTGAAGAACTCGAGTTCTTCAGGCTTTAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000162650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-482s1c1
Sequence:CCGGCAAGTCCTCAGAAGAAACCATCTCGAGATGGTTTCTTCTGAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1282s1c1
Sequence:CCGGGTGACATTCCCAAGTCTCCAACTCGAGTTGGAGACTTGGGAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000163980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1616s1c1
Sequence:CCGGCAGGACCATCAGACCATTCTTCTCGAGAAGAATGGTCTGATGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000164061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1541s1c1
Sequence:CCGGCTTTGAGGCATCACTGAAGGACTCGAGTCCTTCAGTGATGCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032243
TXNDC2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 2 (spermatozoa)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000164408    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1454s1c1
Sequence:CCGGCAAGGAGGGTGACATCCTAAACTCGAGTTTAGGATGTCACCCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163461    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1652s1c1
Sequence:CCGGGAAGCATGAGGATGTGGTGTTCTCGAGAACACCACATCCTCATGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-593s1c1
Sequence:CCGGCCAGCCCAAAGAGAGTAACATCTCGAGATGTTACTCTCTTTGGGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162076    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-535s1c1
Sequence:CCGGCAGAAGAAACCATCCAATCCACTCGAGTGGATTGGATGGTTTCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161649    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1464s1c1
Sequence:CCGGGACATCCTAAAGCCTGAAGAACTCGAGTTCTTCAGGCTTTAGGATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000162650    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-482s1c1
Sequence:CCGGCAAGTCCTCAGAAGAAACCATCTCGAGATGGTTTCTTCTGAGGACTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163043    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1282s1c1
Sequence:CCGGGTGACATTCCCAAGTCTCCAACTCGAGTTGGAGACTTGGGAATGTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000163980    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1616s1c1
Sequence:CCGGCAGGACCATCAGACCATTCTTCTCGAGAAGAATGGTCTGATGGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000164061    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_032243.4-1541s1c1
Sequence:CCGGCTTTGAGGCATCACTGAAGGACTCGAGTCCTTCAGTGATGCCTCAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153519
TXNDC2 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 2 (spermatozoa)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1287s1c1
Sequence:CCGGCCAGGAAGGTAACACTATCAACTCGAGTTGATAGTGTTACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1286s1c1
Sequence:CCGGCCCAGGAAGGTAACACTATCACTCGAGTGATAGTGTTACCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-638s1c1
Sequence:CCGGCCTCAGAAGACATCATCCAATCTCGAGATTGGATGATGTCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1137s1c1
Sequence:CCGGCCATGAATCCATCCAGTCCAACTCGAGTTGGACTGGATGGATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1048s1c1
Sequence:CCGGCAGGACTCAATCCAGTCCAAACTCGAGTTTGGACTGGATTGAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000452869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1583s21c1
Sequence:CCGGTGCAAGACTGTGAGATCTTTCCTCGAGGAAAGATCTCACAGTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000451031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1013s21c1
Sequence:CCGGTTCAGTCCAAGGAGACTAAAGCTCGAGCTTTAGTCTCCTTGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1196s21c1
Sequence:CCGGCATCTAAGGAGGGAGATATTCCTCGAGGAATATCTCCCTCCTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153519
TXNDC2 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 2 (spermatozoa)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1287s1c1
Sequence:CCGGCCAGGAAGGTAACACTATCAACTCGAGTTGATAGTGTTACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1286s1c1
Sequence:CCGGCCCAGGAAGGTAACACTATCACTCGAGTGATAGTGTTACCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-638s1c1
Sequence:CCGGCCTCAGAAGACATCATCCAATCTCGAGATTGGATGATGTCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1137s1c1
Sequence:CCGGCCATGAATCCATCCAGTCCAACTCGAGTTGGACTGGATGGATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1048s1c1
Sequence:CCGGCAGGACTCAATCCAGTCCAAACTCGAGTTTGGACTGGATTGAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000452869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1583s21c1
Sequence:CCGGTGCAAGACTGTGAGATCTTTCCTCGAGGAAAGATCTCACAGTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000451031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1013s21c1
Sequence:CCGGTTCAGTCCAAGGAGACTAAAGCTCGAGCTTTAGTCTCCTTGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1196s21c1
Sequence:CCGGCATCTAAGGAGGGAGATATTCCTCGAGGAATATCTCCCTCCTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153519
TXNDC2 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 2 (spermatozoa)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114381    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1287s1c1
Sequence:CCGGCCAGGAAGGTAACACTATCAACTCGAGTTGATAGTGTTACCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114383    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1286s1c1
Sequence:CCGGCCCAGGAAGGTAACACTATCACTCGAGTGATAGTGTTACCTTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114385    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-638s1c1
Sequence:CCGGCCTCAGAAGACATCATCCAATCTCGAGATTGGATGATGTCTTCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114384    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1137s1c1
Sequence:CCGGCCATGAATCCATCCAGTCCAACTCGAGTTGGACTGGATGGATTCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114382    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153519.1-1048s1c1
Sequence:CCGGCAGGACTCAATCCAGTCCAAACTCGAGTTTGGACTGGATTGAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000452869    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1583s21c1
Sequence:CCGGTGCAAGACTGTGAGATCTTTCCTCGAGGAAAGATCTCACAGTCTTGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000451031    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1013s21c1
Sequence:CCGGTTCAGTCCAAGGAGACTAAAGCTCGAGCTTTAGTCTCCTTGGACTGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440143    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153519.2-1196s21c1
Sequence:CCGGCATCTAAGGAGGGAGATATTCCTCGAGGAATATCTCCCTCCTTAGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks