EMAIL THIS PAGE TO A FRIEND

TXNDC5

thioredoxin domain containing 5 (endoplasmic reticulum)

Synonyms: ENDOPDI ERP46 HCC-2 PDIA15 STRF8 UNQ364
UniProtKB ID: Q8NBS9, B2RDM2, Q5TCQ0, Q8ND33, Q8TCT2, Q9BVH9
Gene ID:
Human(81567) Summary: This gene encodes a protein-disulfide isomerase. Its expression is induced by hypoxia and its role may be to protect hypoxic cells from apoptosis. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the neighboring upstream MUTED (muted homolog) gene. [provided by RefSeq, Dec 2010]
Mouse(105245) thioredoxin domain containing 5
Rat(100362805) thioredoxin domain containing 5 (endoplasmic reticulum)
naked mole-rat(101716947) thioredoxin domain containing 5 (endoplasmic reticulum)
domestic guinea pig(100734063) thioredoxin domain containing 5 (endoplasmic reticulum)
cow(615027) thioredoxin domain containing 5 (endoplasmic reticulum)
sheep(101118393) thioredoxin domain containing 5 (endoplasmic reticulum)
Zebrafish(406289) thioredoxin domain containing 5
Horse(100061945) thioredoxin domain containing 5 (endoplasmic reticulum)
domestic cat(101098632) thioredoxin domain containing 5 (endoplasmic reticulum)
dog(100683583) thioredoxin domain containing 5 (endoplasmic reticulum)
chicken(420867) thioredoxin domain containing 5 (endoplasmic reticulum)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030810 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_030810 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_030810 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145367 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145367 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145367 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022085 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022085 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022085 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU065811 MISSION® esiRNA esiRNA targeting mouse Txndc5 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022085 Rosetta Predictions human pricing
NM_030810 Rosetta Predictions human pricing
NM_145367 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355463 predicted 1683
2 SASI_Hs01_00171689 predicted 1510
3 SASI_Hs01_00171690 predicted 1390
4 SASI_Hs01_00171691 predicted 1567
5 SASI_Hs02_00355464 predicted 802
6 SASI_Hs01_00171695 predicted 670
7 SASI_Hs01_00171696 predicted 1567
8 SASI_Hs01_00171697 predicted 695
9 SASI_Hs02_00355465 predicted 606
10 SASI_Hs02_00355466 predicted 1363
11 SASI_Hs01_00171692 predicted 1327
12 SASI_Hs01_00171693 predicted 1074
13 SASI_Hs01_00171694 predicted 1591
14 SASI_Hs01_00171698 predicted 1331
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030810 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00358384 predicted 1600
2 SASI_Hs01_00020471 predicted 1432
3 SASI_Hs01_00020472 predicted 1308
4 SASI_Hs01_00020473 predicted 1483
5 SASI_Hs02_00358385 predicted 722
6 SASI_Hs01_00020477 predicted 601
7 SASI_Hs01_00020478 predicted 1488
8 SASI_Hs01_00020479 predicted 620
9 SASI_Hs02_00358386 predicted 531
10 SASI_Hs02_00358387 predicted 1280
11 SASI_Hs01_00020474 predicted 1242
12 SASI_Hs01_00020475 predicted 1005
13 SASI_Hs01_00020476 predicted 1511
14 SASI_Hs01_00020480 predicted 1247
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145367 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00068945 predicted 601
2 SASI_Mm01_00068946 predicted 1380
3 SASI_Mm01_00068947 predicted 1171
4 SASI_Mm01_00068948 predicted 198
5 SASI_Mm01_00068949 predicted 1251
6 SASI_Mm01_00068950 predicted 1098
7 SASI_Mm01_00068951 predicted 814
8 SASI_Mm01_00068952 predicted 206
9 SASI_Mm02_00340646 predicted 317
10 SASI_Mm01_00068953 predicted 1285
11 SASI_Mm01_00068944 predicted 307
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030810
TXNDC5 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 5 (endoplasmic reticulum)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000333258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-1309s21c1
Sequence:CCGGGCCAAGCGAAAGACGAACTTTCTCGAGAAAGTTCGTCTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-366s21c1
Sequence:CCGGGCCAAAGTCTATGTGGCTAAACTCGAGTTTAGCCACATAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-743s21c1
Sequence:CCGGCGAAACTGTCAAGATTGGCAACTCGAGTTGCCAATCTTGACAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000333177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-1185s21c1
Sequence:CCGGCGGAATATCTGCAGCAAGTATCTCGAGATACTTGCTGCAGATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030810
TXNDC5 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 5 (endoplasmic reticulum)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000333258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-1309s21c1
Sequence:CCGGGCCAAGCGAAAGACGAACTTTCTCGAGAAAGTTCGTCTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-366s21c1
Sequence:CCGGGCCAAAGTCTATGTGGCTAAACTCGAGTTTAGCCACATAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-743s21c1
Sequence:CCGGCGAAACTGTCAAGATTGGCAACTCGAGTTGCCAATCTTGACAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000333177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-1185s21c1
Sequence:CCGGCGGAATATCTGCAGCAAGTATCTCGAGATACTTGCTGCAGATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030810
TXNDC5 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 5 (endoplasmic reticulum)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000333258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-1309s21c1
Sequence:CCGGGCCAAGCGAAAGACGAACTTTCTCGAGAAAGTTCGTCTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333175    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-366s21c1
Sequence:CCGGGCCAAAGTCTATGTGGCTAAACTCGAGTTTAGCCACATAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333176    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-743s21c1
Sequence:CCGGCGAAACTGTCAAGATTGGCAACTCGAGTTGCCAATCTTGACAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000333177    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_030810.2-1185s21c1
Sequence:CCGGCGGAATATCTGCAGCAAGTATCTCGAGATACTTGCTGCAGATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145367
TXNDC5 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 5 (endoplasmic reticulum)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000331628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145367.3-1677s21c1
Sequence:CCGGGCGGCACTGTTGACTTAGTAACTCGAGTTACTAAGTCAACAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000331627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-610s21c1
Sequence:CCGGGCTGCATGTTTCTCAAGGCAACTCGAGTTGCCTTGAGAAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-474s21c1
Sequence:CCGGGAGACTTTGAAACACTGGAAACTCGAGTTTCCAGTGTTTCAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-1259s21c1
Sequence:CCGGGACTCCTTACACAGCTTTGTTCTCGAGAACAAAGCTGTGTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-1285s21c1
Sequence:CCGGCCAGGCAAAGGATGAACTATACTCGAGTATAGTTCATCCTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145367.2-1664s1c1
Sequence:CCGGGCGGCACTGTTGACTTAGTAACTCGAGTTACTAAGTCAACAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-1246s1c1
Sequence:CCGGGACTCCTTACACAGCTTTGTTCTCGAGAACAAAGCTGTGTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-597s1c1
Sequence:CCGGGCTGCATGTTTCTCAAGGCAACTCGAGTTGCCTTGAGAAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-1272s1c1
Sequence:CCGGCCAGGCAAAGGATGAACTATACTCGAGTATAGTTCATCCTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-461s1c1
Sequence:CCGGGAGACTTTGAAACACTGGAAACTCGAGTTTCCAGTGTTTCAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145367
TXNDC5 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 5 (endoplasmic reticulum)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000331628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145367.3-1677s21c1
Sequence:CCGGGCGGCACTGTTGACTTAGTAACTCGAGTTACTAAGTCAACAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000331627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-610s21c1
Sequence:CCGGGCTGCATGTTTCTCAAGGCAACTCGAGTTGCCTTGAGAAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-474s21c1
Sequence:CCGGGAGACTTTGAAACACTGGAAACTCGAGTTTCCAGTGTTTCAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-1259s21c1
Sequence:CCGGGACTCCTTACACAGCTTTGTTCTCGAGAACAAAGCTGTGTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-1285s21c1
Sequence:CCGGCCAGGCAAAGGATGAACTATACTCGAGTATAGTTCATCCTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145367.2-1664s1c1
Sequence:CCGGGCGGCACTGTTGACTTAGTAACTCGAGTTACTAAGTCAACAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-1246s1c1
Sequence:CCGGGACTCCTTACACAGCTTTGTTCTCGAGAACAAAGCTGTGTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-597s1c1
Sequence:CCGGGCTGCATGTTTCTCAAGGCAACTCGAGTTGCCTTGAGAAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-1272s1c1
Sequence:CCGGCCAGGCAAAGGATGAACTATACTCGAGTATAGTTCATCCTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-461s1c1
Sequence:CCGGGAGACTTTGAAACACTGGAAACTCGAGTTTCCAGTGTTTCAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145367
TXNDC5 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 5 (endoplasmic reticulum)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000331628    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_145367.3-1677s21c1
Sequence:CCGGGCGGCACTGTTGACTTAGTAACTCGAGTTACTAAGTCAACAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000331627    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-610s21c1
Sequence:CCGGGCTGCATGTTTCTCAAGGCAACTCGAGTTGCCTTGAGAAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302663    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-474s21c1
Sequence:CCGGGAGACTTTGAAACACTGGAAACTCGAGTTTCCAGTGTTTCAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302660    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-1259s21c1
Sequence:CCGGGACTCCTTACACAGCTTTGTTCTCGAGAACAAAGCTGTGTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302659    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_145367.3-1285s21c1
Sequence:CCGGCCAGGCAAAGGATGAACTATACTCGAGTATAGTTCATCCTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099700    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145367.2-1664s1c1
Sequence:CCGGGCGGCACTGTTGACTTAGTAACTCGAGTTACTAAGTCAACAGTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-1246s1c1
Sequence:CCGGGACTCCTTACACAGCTTTGTTCTCGAGAACAAAGCTGTGTAAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-597s1c1
Sequence:CCGGGCTGCATGTTTCTCAAGGCAACTCGAGTTGCCTTGAGAAACATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-1272s1c1
Sequence:CCGGCCAGGCAAAGGATGAACTATACTCGAGTATAGTTCATCCTTTGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145367.2-461s1c1
Sequence:CCGGGAGACTTTGAAACACTGGAAACTCGAGTTTCCAGTGTTTCAAAGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022085
VALIDATED
TXNDC5 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 5 (endoplasmic reticulum)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022085.3-727s1c1
Sequence:CCGGCGACCACTTTATCAAGTTCTTCTCGAGAAGAACTTGATAAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022085.3-1262s1c1
Sequence:CCGGCGGAATATCTGCAGCAAGTATCTCGAGATACTTGCTGCAGATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-820s1c1
Sequence:CCGGCGAAACTGTCAAGATTGGCAACTCGAGTTGCCAATCTTGACAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-443s1c1
Sequence:CCGGGCCAAAGTCTATGTGGCTAAACTCGAGTTTAGCCACATAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-1386s1c1
Sequence:CCGGGCCAAGCGAAAGACGAACTTTCTCGAGAAAGTTCGTCTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022085
VALIDATED
TXNDC5 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 5 (endoplasmic reticulum)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022085.3-727s1c1
Sequence:CCGGCGACCACTTTATCAAGTTCTTCTCGAGAAGAACTTGATAAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022085.3-1262s1c1
Sequence:CCGGCGGAATATCTGCAGCAAGTATCTCGAGATACTTGCTGCAGATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-820s1c1
Sequence:CCGGCGAAACTGTCAAGATTGGCAACTCGAGTTGCCAATCTTGACAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-443s1c1
Sequence:CCGGGCCAAAGTCTATGTGGCTAAACTCGAGTTTAGCCACATAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-1386s1c1
Sequence:CCGGGCCAAGCGAAAGACGAACTTTCTCGAGAAAGTTCGTCTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022085
VALIDATED
TXNDC5 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 5 (endoplasmic reticulum)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064353    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022085.3-727s1c1
Sequence:CCGGCGACCACTTTATCAAGTTCTTCTCGAGAAGAACTTGATAAAGTGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064356    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022085.3-1262s1c1
Sequence:CCGGCGGAATATCTGCAGCAAGTATCTCGAGATACTTGCTGCAGATATTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064357    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-820s1c1
Sequence:CCGGCGAAACTGTCAAGATTGGCAACTCGAGTTGCCAATCTTGACAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064355    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-443s1c1
Sequence:CCGGGCCAAAGTCTATGTGGCTAAACTCGAGTTTAGCCACATAGACTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064354    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: A549
TRC Version: 1 Clone ID:NM_022085.3-1386s1c1
Sequence:CCGGGCCAAGCGAAAGACGAACTTTCTCGAGAAAGTTCGTCTTTCGCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks