EMAIL THIS PAGE TO A FRIEND

TXNDC8

thioredoxin domain containing 8 (spermatozoa)

Synonyms: SPTRX-3 TRX6 bA427L11.2
UniProtKB ID: Q6A555, A1L4I2, A6NDK7, Q5T934
Gene ID:
Mouse(67402) thioredoxin domain containing 8
Rat(362525) thioredoxin domain containing 8
cow(777785) thioredoxin domain containing 8 (spermatozoa)
sheep(101113724) thioredoxin domain containing 8 (spermatozoa)
domestic guinea pig(101788549) thioredoxin domain containing 8 (spermatozoa)
naked mole-rat(101712725) thioredoxin domain containing 8 (spermatozoa)
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026132 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026132 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026132 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001003936 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001003936 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001003936 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU228941 MISSION® esiRNA esiRNA targeting human TXNDC8 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001003936 Rosetta Predictions human pricing
NM_001004092 Rosetta Predictions rat pricing
NM_026132 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003936 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00240182 predicted 209
2 SASI_Hs01_00240183 predicted 216
3 SASI_Hs01_00240184 predicted 214
4 SASI_Hs01_00240185 predicted 209
5 SASI_Hs01_00240186 predicted 243
6 SASI_Hs01_00240187 predicted 204
7 SASI_Hs01_00240188 predicted 216
8 SASI_Hs02_00304424 predicted 236
9 SASI_Hs01_00240189 predicted 220
10 SASI_Hs01_00240190 predicted 218
11 SASI_Hs01_00240191 predicted 154
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004092 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058038 predicted 209
2 SASI_Rn01_00058039 predicted 211
3 SASI_Rn01_00058040 predicted 209
4 SASI_Rn01_00058041 predicted 191
5 SASI_Rn01_00058042 predicted 199
6 SASI_Rn01_00058043 predicted 212
7 SASI_Rn01_00058044 predicted 192
8 SASI_Rn01_00058045 predicted 42
9 SASI_Rn01_00058046 predicted 142
10 SASI_Rn01_00058047 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026132 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00066814 predicted 292
2 SASI_Mm02_00329728 predicted 268
3 SASI_Mm01_00066815 predicted 277
4 SASI_Mm02_00329729 predicted 281
5 SASI_Mm01_00066816 predicted 308
6 SASI_Mm01_00066817 predicted 382
7 SASI_Mm01_00066818 predicted 243
8 SASI_Mm01_00066819 predicted 265
9 SASI_Mm01_00066820 predicted 349
10 SASI_Mm02_00329730 predicted 291
11 SASI_Mm01_00066821 predicted 266
12 SASI_Mm01_00066822 predicted 318
13 SASI_Mm01_00066823 predicted 396
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026132
TXNDC8 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 8 (spermatozoa)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-84s1c1
Sequence:CCGGCCAGATGTTAATCATGGTGAACTCGAGTTCACCATGATTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-436s1c1
Sequence:CCGGGCTGATGCTAAACAACTGGAACTCGAGTTCCAGTTGTTTAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-315s1c1
Sequence:CCGGGCTACCCACATTCCAGATGTTCTCGAGAACATCTGGAATGTGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-127s1c1
Sequence:CCGGCTGAAAGAATTGTTCAGCGATCTCGAGATCGCTGAACAATTCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-328s1c1
Sequence:CCGGCAGATGTTCAAGTACACCCAACTCGAGTTGGGTGTACTTGAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026132.2-396s21c1
Sequence:CCGGAGTGGACCGAAGAGCAAGATGCTCGAGCATCTTGCTCTTCGGTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026132.2-270s21c1
Sequence:CCGGGTGGACTCATCTAAGGAATTACTCGAGTAATTCCTTAGATGAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026132
TXNDC8 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 8 (spermatozoa)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-84s1c1
Sequence:CCGGCCAGATGTTAATCATGGTGAACTCGAGTTCACCATGATTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-436s1c1
Sequence:CCGGGCTGATGCTAAACAACTGGAACTCGAGTTCCAGTTGTTTAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-315s1c1
Sequence:CCGGGCTACCCACATTCCAGATGTTCTCGAGAACATCTGGAATGTGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-127s1c1
Sequence:CCGGCTGAAAGAATTGTTCAGCGATCTCGAGATCGCTGAACAATTCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-328s1c1
Sequence:CCGGCAGATGTTCAAGTACACCCAACTCGAGTTGGGTGTACTTGAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026132.2-396s21c1
Sequence:CCGGAGTGGACCGAAGAGCAAGATGCTCGAGCATCTTGCTCTTCGGTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026132.2-270s21c1
Sequence:CCGGGTGGACTCATCTAAGGAATTACTCGAGTAATTCCTTAGATGAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026132
TXNDC8 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 8 (spermatozoa)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114386    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-84s1c1
Sequence:CCGGCCAGATGTTAATCATGGTGAACTCGAGTTCACCATGATTAACATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-436s1c1
Sequence:CCGGGCTGATGCTAAACAACTGGAACTCGAGTTCCAGTTGTTTAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114387    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-315s1c1
Sequence:CCGGGCTACCCACATTCCAGATGTTCTCGAGAACATCTGGAATGTGGGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-127s1c1
Sequence:CCGGCTGAAAGAATTGTTCAGCGATCTCGAGATCGCTGAACAATTCTTTCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026132.1-328s1c1
Sequence:CCGGCAGATGTTCAAGTACACCCAACTCGAGTTGGGTGTACTTGAACATCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435724    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026132.2-396s21c1
Sequence:CCGGAGTGGACCGAAGAGCAAGATGCTCGAGCATCTTGCTCTTCGGTCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026132.2-270s21c1
Sequence:CCGGGTGGACTCATCTAAGGAATTACTCGAGTAATTCCTTAGATGAGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001003936
TXNDC8 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 8 (spermatozoa)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-154s1c1
Sequence:CCGGCCATGCTATGTCTGTGAAATACTCGAGTATTTCACAGACATAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-220s1c1
Sequence:CCGGGCTGGCTGAAACTTGTCACATCTCGAGATGTGACAAGTTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-87s1c1
Sequence:CCGGACAAACTCGCAGTGGTTCAATCTCGAGATTGAACCACTGCGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-191s1c1
Sequence:CCGGGCTAATGTGGATGTGAACAATCTCGAGATTGTTCACATCCACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003936.2-333s21c1
Sequence:CCGGTAATTTGCTGTTATAGAAGTGCTCGAGCACTTCTATAACAGCAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003936.2-305s21c1
Sequence:CCGGGTAACCCTATTCTCAAGAATCCTCGAGGATTCTTGAGAATAGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001003936
TXNDC8 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 8 (spermatozoa)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-154s1c1
Sequence:CCGGCCATGCTATGTCTGTGAAATACTCGAGTATTTCACAGACATAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-220s1c1
Sequence:CCGGGCTGGCTGAAACTTGTCACATCTCGAGATGTGACAAGTTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-87s1c1
Sequence:CCGGACAAACTCGCAGTGGTTCAATCTCGAGATTGAACCACTGCGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-191s1c1
Sequence:CCGGGCTAATGTGGATGTGAACAATCTCGAGATTGTTCACATCCACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003936.2-333s21c1
Sequence:CCGGTAATTTGCTGTTATAGAAGTGCTCGAGCACTTCTATAACAGCAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003936.2-305s21c1
Sequence:CCGGGTAACCCTATTCTCAAGAATCCTCGAGGATTCTTGAGAATAGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001003936
TXNDC8 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 8 (spermatozoa)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060033    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-154s1c1
Sequence:CCGGCCATGCTATGTCTGTGAAATACTCGAGTATTTCACAGACATAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060034    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-220s1c1
Sequence:CCGGGCTGGCTGAAACTTGTCACATCTCGAGATGTGACAAGTTTCAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060037    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-87s1c1
Sequence:CCGGACAAACTCGCAGTGGTTCAATCTCGAGATTGAACCACTGCGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060036    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001003936.1-191s1c1
Sequence:CCGGGCTAATGTGGATGTGAACAATCTCGAGATTGTTCACATCCACATTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436026    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003936.2-333s21c1
Sequence:CCGGTAATTTGCTGTTATAGAAGTGCTCGAGCACTTCTATAACAGCAAATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412717    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001003936.2-305s21c1
Sequence:CCGGGTAACCCTATTCTCAAGAATCCTCGAGGATTCTTGAGAATAGGGTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks