EMAIL THIS PAGE TO A FRIEND

TXNDC9

thioredoxin domain containing 9

Synonyms: APACD PHLP3
Gene ID:
Human(10190) Summary: The protein encoded by this gene is a member of the thioredoxin family. The exact function of this protein is not known but it is associated with cell differentiation. [provided by RefSeq, Jul 2008]
Mouse(98258) thioredoxin domain containing 9
Rat(280671) thioredoxin domain containing 9
naked mole-rat(101698946) thioredoxin domain containing 9
domestic guinea pig(100723650) thioredoxin domain containing 9
cow(539143) thioredoxin domain containing 9
sheep(101106316) thioredoxin domain containing 9
Zebrafish(336625) thioredoxin domain containing 9
domestic cat(101086387) thioredoxin domain containing 9
chicken(418702) thioredoxin domain containing 9
dog(474557) thioredoxin domain containing 9
88 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172054 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172054 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172054 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005783 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005783 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005783 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005783 Rosetta Predictions human pricing
NM_172032 Rosetta Predictions rat pricing
NM_172054 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005783 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207281 predicted 668
2 SASI_Hs01_00207282 predicted 1262
3 SASI_Hs01_00207283 predicted 401
4 SASI_Hs01_00207284 predicted 1244
5 SASI_Hs01_00207285 predicted 1251
6 SASI_Hs01_00207286 predicted 655
7 SASI_Hs01_00207289 predicted 256
8 SASI_Hs01_00207290 predicted 249
9 SASI_Hs02_00340277 predicted 1261
10 SASI_Hs02_00340278 predicted 305
11 SASI_Hs01_00207287 predicted 275
12 SASI_Hs01_00207288 predicted 358
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172032 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00038737 predicted 563
2 SASI_Rn01_00038738 predicted 377
3 SASI_Rn01_00038739 predicted 209
4 SASI_Rn01_00038740 predicted 561
5 SASI_Rn01_00038741 predicted 494
6 SASI_Rn01_00038742 predicted 515
7 SASI_Rn02_00269121 predicted 580
8 SASI_Rn01_00038744 predicted 397
9 SASI_Rn01_00038745 predicted 339
10 SASI_Rn02_00269122 predicted 376
11 SASI_Rn01_00038743 predicted 585
12 SASI_Rn01_00038746 predicted 373
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172054 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085541 predicted 1050
2 SASI_Mm01_00085543 predicted 1108
3 SASI_Mm01_00085544 predicted 519
4 SASI_Mm02_00343647 predicted 350
5 SASI_Mm01_00085545 predicted 1107
6 SASI_Mm01_00085546 predicted 509
7 SASI_Mm01_00085547 predicted 411
8 SASI_Mm01_00085548 predicted 597
9 SASI_Mm01_00085549 predicted 1176
10 SASI_Mm01_00085550 predicted 588
11 SASI_Mm01_00085542 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172054
VALIDATED
TXNDC9 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 9
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000329640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172054.4-581s21c1
Sequence:CCGGCGCAAGATTATGTTGTTGGATCTCGAGATCCAACAACATAATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-798s1c1
Sequence:CCGGCTAGACTGTGCTGTACTTTAACTCGAGTTAAAGTACAGCACAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-439s1c1
Sequence:CCGGCTAGACAGACATTTGGCAATTCTCGAGAATTGCCAAATGTCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172054.4-1265s1c1
Sequence:CCGGGTGAGCACATCGCCTTATTTACTCGAGTAAATAAGGCGATGTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-388s1c1
Sequence:CCGGGAGAAAGTGGTTTGCCATTTCCTCGAGGAAATGGCAAACCACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172054.4-637s21c1
Sequence:CCGGGAAACTTTAGAATGGAGACTTCTCGAGAAGTCTCCATTCTAAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172054.4-1305s21c1
Sequence:CCGGGCACATTATGAGACCTGCAAACTCGAGTTTGCAGGTCTCATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172054.4-183s21c1
Sequence:CCGGCGCTAAGCTGGTGGAGAATCACTCGAGTGATTCTCCACCAGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-193s1c1
Sequence:CCGGGAGAATCACTTGGACTCTGAACTCGAGTTCAGAGTCCAAGTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-578s1c1
Sequence:CCGGCGCAAGATTATGTTGTTGGATCTCGAGATCCAACAACATAATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-634s1c1
Sequence:CCGGGAAACTTTAGAATGGAGACTTCTCGAGAAGTCTCCATTCTAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.2-728s1c1
Sequence:CCGGCAAACTTTACAAAGCTGGAAACTCGAGTTTCCAGCTTTGTAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172054.2-1302s1c1
Sequence:CCGGGCACATTATGAGACCTGCAAACTCGAGTTTGCAGGTCTCATAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172054
VALIDATED
TXNDC9 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 9
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000329640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172054.4-581s21c1
Sequence:CCGGCGCAAGATTATGTTGTTGGATCTCGAGATCCAACAACATAATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-798s1c1
Sequence:CCGGCTAGACTGTGCTGTACTTTAACTCGAGTTAAAGTACAGCACAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-439s1c1
Sequence:CCGGCTAGACAGACATTTGGCAATTCTCGAGAATTGCCAAATGTCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172054.4-1265s1c1
Sequence:CCGGGTGAGCACATCGCCTTATTTACTCGAGTAAATAAGGCGATGTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-388s1c1
Sequence:CCGGGAGAAAGTGGTTTGCCATTTCCTCGAGGAAATGGCAAACCACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172054.4-637s21c1
Sequence:CCGGGAAACTTTAGAATGGAGACTTCTCGAGAAGTCTCCATTCTAAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172054.4-1305s21c1
Sequence:CCGGGCACATTATGAGACCTGCAAACTCGAGTTTGCAGGTCTCATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172054.4-183s21c1
Sequence:CCGGCGCTAAGCTGGTGGAGAATCACTCGAGTGATTCTCCACCAGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-193s1c1
Sequence:CCGGGAGAATCACTTGGACTCTGAACTCGAGTTCAGAGTCCAAGTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-578s1c1
Sequence:CCGGCGCAAGATTATGTTGTTGGATCTCGAGATCCAACAACATAATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-634s1c1
Sequence:CCGGGAAACTTTAGAATGGAGACTTCTCGAGAAGTCTCCATTCTAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.2-728s1c1
Sequence:CCGGCAAACTTTACAAAGCTGGAAACTCGAGTTTCCAGCTTTGTAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172054.2-1302s1c1
Sequence:CCGGGCACATTATGAGACCTGCAAACTCGAGTTTGCAGGTCTCATAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172054
VALIDATED
TXNDC9 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 9
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000329640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172054.4-581s21c1
Sequence:CCGGCGCAAGATTATGTTGTTGGATCTCGAGATCCAACAACATAATCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216066    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-798s1c1
Sequence:CCGGCTAGACTGTGCTGTACTTTAACTCGAGTTAAAGTACAGCACAGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216065    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-439s1c1
Sequence:CCGGCTAGACAGACATTTGGCAATTCTCGAGAATTGCCAAATGTCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216900    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_172054.4-1265s1c1
Sequence:CCGGGTGAGCACATCGCCTTATTTACTCGAGTAAATAAGGCGATGTGCTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217334    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.4-388s1c1
Sequence:CCGGGAGAAAGTGGTTTGCCATTTCCTCGAGGAAATGGCAAACCACTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172054.4-637s21c1
Sequence:CCGGGAAACTTTAGAATGGAGACTTCTCGAGAAGTCTCCATTCTAAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329573    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172054.4-1305s21c1
Sequence:CCGGGCACATTATGAGACCTGCAAACTCGAGTTTGCAGGTCTCATAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329574    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172054.4-183s21c1
Sequence:CCGGCGCTAAGCTGGTGGAGAATCACTCGAGTGATTCTCCACCAGCTTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-193s1c1
Sequence:CCGGGAGAATCACTTGGACTCTGAACTCGAGTTCAGAGTCCAAGTGATTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177704    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-578s1c1
Sequence:CCGGCGCAAGATTATGTTGTTGGATCTCGAGATCCAACAACATAATCTTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177014    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172054.2-634s1c1
Sequence:CCGGGAAACTTTAGAATGGAGACTTCTCGAGAAGTCTCCATTCTAAAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_172054.2-728s1c1
Sequence:CCGGCAAACTTTACAAAGCTGGAAACTCGAGTTTCCAGCTTTGTAAAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181666    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172054.2-1302s1c1
Sequence:CCGGGCACATTATGAGACCTGCAAACTCGAGTTTGCAGGTCTCATAATGTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005783
VALIDATED
TXNDC9 MISSION shRNA Bacterial Glycerol Stock
thioredoxin domain containing 9
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000271540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-863s21c1
Sequence:CCGGTGATGATTAGAGCTCAATAATCTCGAGATTATTGAGCTCTAATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000284405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-728s21c1
Sequence:CCGGCGGTTCTTCTGACATTCTTAACTCGAGTTAAGAATGTCAGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-656s21c1
Sequence:CCGGAGATTATGTTGTTGGGTTTACCTCGAGGTAAACCCAACAACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000271537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005783.3-1202s21c1
Sequence:CCGGCTAATTCTTAATCGGCATTATCTCGAGATAATGCCGATTAAGAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005783.2-770s1c1
Sequence:CCGGTCCGAGGAAAGAAATATGATTCTCGAGAATCATATTTCTTTCCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005783.2-740s1c1
Sequence:CCGGCAAACTTCACAAAGCTGGAAACTCGAGTTTCCAGCTTTGTGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-249s1c1
Sequence:CCGGTGAGGATGAATTGGAACGCCTCTCGAGAGGCGTTCCAATTCATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-447s1c1
Sequence:CCGGACTAGACAGACATCTGGCAATCTCGAGATTGCCAGATGTCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-706s1c1
Sequence:CCGGGAGCCACCATTTCAGAACCAACTCGAGTTGGTTCTGAAATGGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005783
VALIDATED
TXNDC9 MISSION shRNA shRNA Plasmid DNA
thioredoxin domain containing 9
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000271540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-863s21c1
Sequence:CCGGTGATGATTAGAGCTCAATAATCTCGAGATTATTGAGCTCTAATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000284405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-728s21c1
Sequence:CCGGCGGTTCTTCTGACATTCTTAACTCGAGTTAAGAATGTCAGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-656s21c1
Sequence:CCGGAGATTATGTTGTTGGGTTTACCTCGAGGTAAACCCAACAACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000271537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005783.3-1202s21c1
Sequence:CCGGCTAATTCTTAATCGGCATTATCTCGAGATAATGCCGATTAAGAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005783.2-770s1c1
Sequence:CCGGTCCGAGGAAAGAAATATGATTCTCGAGAATCATATTTCTTTCCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005783.2-740s1c1
Sequence:CCGGCAAACTTCACAAAGCTGGAAACTCGAGTTTCCAGCTTTGTGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-249s1c1
Sequence:CCGGTGAGGATGAATTGGAACGCCTCTCGAGAGGCGTTCCAATTCATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-447s1c1
Sequence:CCGGACTAGACAGACATCTGGCAATCTCGAGATTGCCAGATGTCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-706s1c1
Sequence:CCGGGAGCCACCATTTCAGAACCAACTCGAGTTGGTTCTGAAATGGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005783
VALIDATED
TXNDC9 MISSION shRNA Lentiviral Transduction Particles
thioredoxin domain containing 9
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000271540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-863s21c1
Sequence:CCGGTGATGATTAGAGCTCAATAATCTCGAGATTATTGAGCTCTAATCATCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000284405    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-728s21c1
Sequence:CCGGCGGTTCTTCTGACATTCTTAACTCGAGTTAAGAATGTCAGAAGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271538    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005783.3-656s21c1
Sequence:CCGGAGATTATGTTGTTGGGTTTACCTCGAGGTAAACCCAACAACATAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000271537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005783.3-1202s21c1
Sequence:CCGGCTAATTCTTAATCGGCATTATCTCGAGATAATGCCGATTAAGAATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_005783.2-770s1c1
Sequence:CCGGTCCGAGGAAAGAAATATGATTCTCGAGAATCATATTTCTTTCCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064608    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A549
TRC Version: 1 Clone ID:NM_005783.2-740s1c1
Sequence:CCGGCAAACTTCACAAAGCTGGAAACTCGAGTTTCCAGCTTTGTGAAGTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-249s1c1
Sequence:CCGGTGAGGATGAATTGGAACGCCTCTCGAGAGGCGTTCCAATTCATCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-447s1c1
Sequence:CCGGACTAGACAGACATCTGGCAATCTCGAGATTGCCAGATGTCTGTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005783.2-706s1c1
Sequence:CCGGGAGCCACCATTTCAGAACCAACTCGAGTTGGTTCTGAAATGGTGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks