EMAIL THIS PAGE TO A FRIEND

TXNIP

thioredoxin interacting protein

Synonyms: EST01027 HHCPA78 THIF VDUP1
UniProtKB ID: Q9H3M7, Q16226, Q6PML0, Q9BXG9
Gene ID:
Mouse(56338) thioredoxin interacting protein
Rat(117514) thioredoxin interacting protein
dog(475829) thioredoxin interacting protein
domestic cat(101099739) thioredoxin interacting protein
cow(506790) thioredoxin interacting protein
domestic guinea pig(100732796) thioredoxin interacting protein
naked mole-rat(101705419) thioredoxin interacting protein
Domestic Rabbit(100355951) thioredoxin interacting protein
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_023719 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023719 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023719 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006472 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006472 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006472 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006472 Rosetta Predictions human pricing
NM_001008767 Rosetta Predictions rat pricing
NM_001009935 Rosetta Predictions mouse pricing
NM_023719 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006472 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00184126 predicted 937
2 SASI_Hs01_00184127 predicted 1556
3 SASI_Hs01_00184129 predicted 1464
4 SASI_Hs01_00184130 predicted 1188
5 SASI_Hs01_00184131 predicted 797
6 SASI_Hs01_00184132 predicted 1327
7 SASI_Hs01_00184133 predicted 1034
8 SASI_Hs01_00184134 predicted 1061
9 SASI_Hs01_00184135 predicted 1140
10 SASI_Hs02_00341649 predicted 1411
11 SASI_Hs01_00184128 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008767 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00114569 predicted 644
2 SASI_Rn01_00114570 predicted 986
3 SASI_Rn01_00114572 predicted 620
4 SASI_Rn02_00199276 predicted 300
5 SASI_Rn01_00114573 predicted 909
6 SASI_Rn01_00114574 predicted 822
7 SASI_Rn01_00114575 predicted 1388
8 SASI_Rn01_00114576 predicted 631
9 SASI_Rn02_00199277 predicted 1196
10 SASI_Rn01_00114577 predicted 512
11 SASI_Rn01_00114571 predicted 886
12 SASI_Rn01_00114578 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009935 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103983 predicted 913
2 SASI_Mm01_00103984 predicted 926
3 SASI_Mm01_00103985 predicted 945
4 SASI_Mm01_00103986 predicted 935
5 SASI_Mm01_00103987 predicted 1668
6 SASI_Mm01_00103988 predicted 712
7 SASI_Mm01_00103989 predicted 1075
8 SASI_Mm02_00286875 predicted 1495
9 SASI_Mm01_00103990 predicted 392
10 SASI_Mm01_00103991 predicted 720
11 SASI_Mm01_00103992 predicted 370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023719 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00138870 predicted 915
2 SASI_Mm01_00138871 predicted 930
3 SASI_Mm01_00138872 predicted 938
4 SASI_Mm01_00138873 predicted 930
5 SASI_Mm01_00138874 predicted 1663
6 SASI_Mm01_00138875 predicted 712
7 SASI_Mm01_00138876 predicted 1077
8 SASI_Mm02_00327305 predicted 1496
9 SASI_Mm01_00138877 predicted 388
10 SASI_Mm01_00138878 predicted 716
11 SASI_Mm01_00138879 predicted 364
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023719
VALIDATED
TXNIP MISSION shRNA Bacterial Glycerol Stock
thioredoxin interacting protein
Mouse
15 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-1049s1c1
Sequence:CCGGGCAGAAGATCAGACCATCCATCTCGAGATGGATGGTCTGATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023719.1-467s1c1
Sequence:CCGGCAAACAGACTTTGGACTACTTCTCGAGAAGTAGTCCAAAGTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-554s1c1
Sequence:CCGGGCCTGGAAACAAATATGAGTACTCGAGTACTCATATTTGTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023719.1-1475s1c1
Sequence:CCGGCAGGAAATGAAGCATCTGTATCTCGAGATACAGATGCTTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-1474s1c1
Sequence:CCGGGCAGGAAATGAAGCATCTGTACTCGAGTACAGATGCTTCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023719.1-2361s1c1
Sequence:CCGGGCCCAGCTTGGTTATTGCTTTCTCGAGAAAGCAATAACCAAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-1426s1c1
Sequence:CCGGCGTGCGTCCTTAACAACAACACTCGAGTGTTGTTGTTAAGGACGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023719.1-773s1c1
Sequence:CCGGGAAGAAAGTTTCCTGCATGTTCTCGAGAACATGCAGGAAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-930s1c1
Sequence:CCGGCGACACACTTACCTTGCCAATCTCGAGATTGGCAAGGTAAGTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023719.2-1352s21c1
Sequence:CCGGCTCAAGACAGCCCTATCTTTACTCGAGTAAAGATAGGGCTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1080s21c1
Sequence:CCGGCAACATCCTCAAAGTCGAATACTCGAGTATTCGACTTTGAGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000219584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-1351s1c1
Sequence:CCGGCTCAAGACAGTCCTATCTTTACTCGAGTAAAGATAGGACTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1050s21c1
Sequence:CCGGGCAGAAGATCAGACCATCCATCTCGAGATGGATGGTCTGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023719.2-812s21c1
Sequence:CCGGTGTCAGTCTCTGCTCGAATTGCTCGAGCAATTCGAGCAGAGACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000347096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1486s21c1
Sequence:CCGGAGCATCTGTATTAGCGCATTTCTCGAGAAATGCGCTAATACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023719
VALIDATED
TXNIP MISSION shRNA shRNA Plasmid DNA
thioredoxin interacting protein
Mouse
15 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-1049s1c1
Sequence:CCGGGCAGAAGATCAGACCATCCATCTCGAGATGGATGGTCTGATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023719.1-467s1c1
Sequence:CCGGCAAACAGACTTTGGACTACTTCTCGAGAAGTAGTCCAAAGTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-554s1c1
Sequence:CCGGGCCTGGAAACAAATATGAGTACTCGAGTACTCATATTTGTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023719.1-1475s1c1
Sequence:CCGGCAGGAAATGAAGCATCTGTATCTCGAGATACAGATGCTTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-1474s1c1
Sequence:CCGGGCAGGAAATGAAGCATCTGTACTCGAGTACAGATGCTTCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023719.1-2361s1c1
Sequence:CCGGGCCCAGCTTGGTTATTGCTTTCTCGAGAAAGCAATAACCAAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-1426s1c1
Sequence:CCGGCGTGCGTCCTTAACAACAACACTCGAGTGTTGTTGTTAAGGACGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023719.1-773s1c1
Sequence:CCGGGAAGAAAGTTTCCTGCATGTTCTCGAGAACATGCAGGAAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-930s1c1
Sequence:CCGGCGACACACTTACCTTGCCAATCTCGAGATTGGCAAGGTAAGTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023719.2-1352s21c1
Sequence:CCGGCTCAAGACAGCCCTATCTTTACTCGAGTAAAGATAGGGCTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1080s21c1
Sequence:CCGGCAACATCCTCAAAGTCGAATACTCGAGTATTCGACTTTGAGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000219584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-1351s1c1
Sequence:CCGGCTCAAGACAGTCCTATCTTTACTCGAGTAAAGATAGGACTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1050s21c1
Sequence:CCGGGCAGAAGATCAGACCATCCATCTCGAGATGGATGGTCTGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023719.2-812s21c1
Sequence:CCGGTGTCAGTCTCTGCTCGAATTGCTCGAGCAATTCGAGCAGAGACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000347096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1486s21c1
Sequence:CCGGAGCATCTGTATTAGCGCATTTCTCGAGAAATGCGCTAATACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023719
VALIDATED
TXNIP MISSION shRNA Lentiviral Transduction Particles
thioredoxin interacting protein
Mouse
15 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182360    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-1049s1c1
Sequence:CCGGGCAGAAGATCAGACCATCCATCTCGAGATGGATGGTCTGATCTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177644    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023719.1-467s1c1
Sequence:CCGGCAAACAGACTTTGGACTACTTCTCGAGAAGTAGTCCAAAGTCTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-554s1c1
Sequence:CCGGGCCTGGAAACAAATATGAGTACTCGAGTACTCATATTTGTTTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178187    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_023719.1-1475s1c1
Sequence:CCGGCAGGAAATGAAGCATCTGTATCTCGAGATACAGATGCTTCATTTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181578    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_023719.1-1474s1c1
Sequence:CCGGGCAGGAAATGAAGCATCTGTACTCGAGTACAGATGCTTCATTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200391    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_023719.1-2361s1c1
Sequence:CCGGGCCCAGCTTGGTTATTGCTTTCTCGAGAAAGCAATAACCAAGCTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200200    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-1426s1c1
Sequence:CCGGCGTGCGTCCTTAACAACAACACTCGAGTGTTGTTGTTAAGGACGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1.5 Clone ID:NM_023719.1-773s1c1
Sequence:CCGGGAAGAAAGTTTCCTGCATGTTCTCGAGAACATGCAGGAAACTTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200102    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-930s1c1
Sequence:CCGGCGACACACTTACCTTGCCAATCTCGAGATTGGCAAGGTAAGTGTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347089    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023719.2-1352s21c1
Sequence:CCGGCTCAAGACAGCCCTATCTTTACTCGAGTAAAGATAGGGCTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347097    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1080s21c1
Sequence:CCGGCAACATCCTCAAAGTCGAATACTCGAGTATTCGACTTTGAGGATGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000219584    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_023719.1-1351s1c1
Sequence:CCGGCTCAAGACAGTCCTATCTTTACTCGAGTAAAGATAGGACTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347019    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1050s21c1
Sequence:CCGGGCAGAAGATCAGACCATCCATCTCGAGATGGATGGTCTGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347098    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023719.2-812s21c1
Sequence:CCGGTGTCAGTCTCTGCTCGAATTGCTCGAGCAATTCGAGCAGAGACTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000347096    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_023719.2-1486s21c1
Sequence:CCGGAGCATCTGTATTAGCGCATTTCTCGAGAAATGCGCTAATACAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006472
VALIDATED
TXNIP MISSION shRNA Bacterial Glycerol Stock
thioredoxin interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1215s1c1
Sequence:CCGGCCCTGCTATATGGATGTCATTCTCGAGAATGACATCCATATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1347s1c1
Sequence:CCGGCCGACTTATACTGAGGTGGATCTCGAGATCCACCTCAGTATAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-624s1c1
Sequence:CCGGCCAACTCAAGAGACAAAGAAACTCGAGTTTCTTTGTCTCTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-255s1c1
Sequence:CCGGGTGGTCTTTAACGACCCTGAACTCGAGTTCAGGGTCGTTAAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1021s1c1
Sequence:CCGGGCAACATCCTTCGAGTTGAATCTCGAGATTCAACTCGAAGGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-1046s21c1
Sequence:CCGGATCAGTCAGAGGCAATCATATCTCGAGATATGATTGCCTCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-946s21c1
Sequence:CCGGAGAATACATGTTCCCGAATTGCTCGAGCAATTCGGGAACATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000262800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-1414s21c1
Sequence:CCGGCTCAAGACAGCCCTATCTTTACTCGAGTAAAGATAGGGCTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006472.3-1666s21c1
Sequence:CCGGGGCAATCTCCTGGGCCTTAAACTCGAGTTTAAGGCCCAGGAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006472
VALIDATED
TXNIP MISSION shRNA shRNA Plasmid DNA
thioredoxin interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1215s1c1
Sequence:CCGGCCCTGCTATATGGATGTCATTCTCGAGAATGACATCCATATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1347s1c1
Sequence:CCGGCCGACTTATACTGAGGTGGATCTCGAGATCCACCTCAGTATAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-624s1c1
Sequence:CCGGCCAACTCAAGAGACAAAGAAACTCGAGTTTCTTTGTCTCTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-255s1c1
Sequence:CCGGGTGGTCTTTAACGACCCTGAACTCGAGTTCAGGGTCGTTAAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1021s1c1
Sequence:CCGGGCAACATCCTTCGAGTTGAATCTCGAGATTCAACTCGAAGGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-1046s21c1
Sequence:CCGGATCAGTCAGAGGCAATCATATCTCGAGATATGATTGCCTCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-946s21c1
Sequence:CCGGAGAATACATGTTCCCGAATTGCTCGAGCAATTCGGGAACATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000262800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-1414s21c1
Sequence:CCGGCTCAAGACAGCCCTATCTTTACTCGAGTAAAGATAGGGCTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006472.3-1666s21c1
Sequence:CCGGGGCAATCTCCTGGGCCTTAAACTCGAGTTTAAGGCCCAGGAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006472
VALIDATED
TXNIP MISSION shRNA Lentiviral Transduction Particles
thioredoxin interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1215s1c1
Sequence:CCGGCCCTGCTATATGGATGTCATTCTCGAGAATGACATCCATATAGCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059060    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1347s1c1
Sequence:CCGGCCGACTTATACTGAGGTGGATCTCGAGATCCACCTCAGTATAAGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-624s1c1
Sequence:CCGGCCAACTCAAGAGACAAAGAAACTCGAGTTTCTTTGTCTCTTGAGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059061    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-255s1c1
Sequence:CCGGGTGGTCTTTAACGACCCTGAACTCGAGTTCAGGGTCGTTAAAGACCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059062    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006472.1-1021s1c1
Sequence:CCGGGCAACATCCTTCGAGTTGAATCTCGAGATTCAACTCGAAGGATGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262802    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-1046s21c1
Sequence:CCGGATCAGTCAGAGGCAATCATATCTCGAGATATGATTGCCTCTGACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-946s21c1
Sequence:CCGGAGAATACATGTTCCCGAATTGCTCGAGCAATTCGGGAACATGTATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000262800    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006472.3-1414s21c1
Sequence:CCGGCTCAAGACAGCCCTATCTTTACTCGAGTAAAGATAGGGCTGTCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282428    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: HeLa
TRC Version: 2 Clone ID:NM_006472.3-1666s21c1
Sequence:CCGGGGCAATCTCCTGGGCCTTAAACTCGAGTTTAAGGCCCAGGAGATTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks