EMAIL THIS PAGE TO A FRIEND

TXNL1

thioredoxin-like 1

Synonyms: TRP32 TXL-1 TXNL Txl
UniProtKB ID: O43396
Gene ID:
Mouse(53382) thioredoxin-like 1
Rat(140922) thioredoxin-like 1
Zebrafish(394113) thioredoxin-like 1
chicken(426854) thioredoxin-like 1
dog(483970) thioredoxin-like 1
domestic cat(101099843) thioredoxin-like 1
naked mole-rat(101710634) thioredoxin-like 1
domestic guinea pig(100729559) thioredoxin-like 1
cow(509142) thioredoxin-like 1
Goat(100861020) thioredoxin-like 1
sheep(101121817) thioredoxin-like 1
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_016792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_016792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004786 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004786 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004786 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004786 Rosetta Predictions human pricing
NM_080887 Rosetta Predictions rat pricing
NM_016792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247131 predicted 686
2 SASI_Hs01_00247132 predicted 654
3 SASI_Hs01_00247133 predicted 458
4 SASI_Hs02_00338301 predicted 723
5 SASI_Hs01_00247134 predicted 1057
6 SASI_Hs01_00247135 predicted 856
7 SASI_Hs01_00247136 predicted 542
8 SASI_Hs01_00247138 predicted 844
9 SASI_Hs02_00338302 predicted 1027
10 SASI_Hs02_00338303 predicted 568
11 SASI_Hs01_00247137 predicted 726
12 SASI_Hs01_00247139 predicted 920
13 SASI_Hs01_00247140 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080887 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00086555 predicted 884
2 SASI_Rn01_00086556 predicted 722
3 SASI_Rn01_00086557 predicted 933
4 SASI_Rn01_00086558 predicted 973
5 SASI_Rn01_00086559 predicted 555
6 SASI_Rn01_00086560 predicted 552
7 SASI_Rn01_00086562 predicted 1013
8 SASI_Rn01_00086563 predicted 934
9 SASI_Rn02_00267339 predicted 240
10 SASI_Rn01_00086564 predicted 716
11 SASI_Rn01_00086561 predicted 466
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00160518 predicted 679
2 SASI_Mm01_00160519 predicted 614
3 SASI_Mm01_00160520 predicted 690
4 SASI_Mm01_00160522 predicted 435
5 SASI_Mm01_00160524 predicted 586
6 SASI_Mm01_00160525 predicted 1084
7 SASI_Mm02_00323572 predicted 663
8 SASI_Mm01_00160526 predicted 704
9 SASI_Mm02_00323573 predicted 693
10 SASI_Mm02_00323574 predicted 700
11 SASI_Mm01_00160521 predicted 719
12 SASI_Mm01_00160523 predicted 922
13 SASI_Mm01_00160527 predicted 1020
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016792
VALIDATED
TXNL1 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-like 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000341087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-346s21c1
Sequence:CCGGGCAGTCTTCTTGGAAGTAGATCTCGAGATCTACTTCCAAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-616s21c1
Sequence:CCGGCACGGCTTTGACAACTGTTTACTCGAGTAAACAGTTGTCAAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-678s21c1
Sequence:CCGGGCTCCTTATTACTGTGGCATTCTCGAGAATGCCACAGTAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000341012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016792.4-1337s21c1
Sequence:CCGGTCTAGTATCACATTGACTAAACTCGAGTTTAGTCAATGTGATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016792.2-2087s1c1
Sequence:CCGGGCTTCCATGTATGTGTATATTCTCGAGAATATACACATACATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016792.2-347s1c1
Sequence:CCGGGCAGTCTTCTTGGAAGTAGATCTCGAGATCTACTTCCAAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016792.2-617s1c1
Sequence:CCGGCACGGCTTTGACAACTGTTTACTCGAGTAAACAGTTGTCAAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016792.2-679s1c1
Sequence:CCGGGCTCCTTATTACTGTGGCATTCTCGAGAATGCCACAGTAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016792
VALIDATED
TXNL1 MISSION shRNA shRNA Plasmid DNA
thioredoxin-like 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000341087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-346s21c1
Sequence:CCGGGCAGTCTTCTTGGAAGTAGATCTCGAGATCTACTTCCAAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-616s21c1
Sequence:CCGGCACGGCTTTGACAACTGTTTACTCGAGTAAACAGTTGTCAAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-678s21c1
Sequence:CCGGGCTCCTTATTACTGTGGCATTCTCGAGAATGCCACAGTAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000341012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016792.4-1337s21c1
Sequence:CCGGTCTAGTATCACATTGACTAAACTCGAGTTTAGTCAATGTGATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016792.2-2087s1c1
Sequence:CCGGGCTTCCATGTATGTGTATATTCTCGAGAATATACACATACATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016792.2-347s1c1
Sequence:CCGGGCAGTCTTCTTGGAAGTAGATCTCGAGATCTACTTCCAAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016792.2-617s1c1
Sequence:CCGGCACGGCTTTGACAACTGTTTACTCGAGTAAACAGTTGTCAAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016792.2-679s1c1
Sequence:CCGGGCTCCTTATTACTGTGGCATTCTCGAGAATGCCACAGTAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016792
VALIDATED
TXNL1 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-like 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000341087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-346s21c1
Sequence:CCGGGCAGTCTTCTTGGAAGTAGATCTCGAGATCTACTTCCAAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341010    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-616s21c1
Sequence:CCGGCACGGCTTTGACAACTGTTTACTCGAGTAAACAGTTGTCAAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341011    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016792.4-678s21c1
Sequence:CCGGGCTCCTTATTACTGTGGCATTCTCGAGAATGCCACAGTAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000341012    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016792.4-1337s21c1
Sequence:CCGGTCTAGTATCACATTGACTAAACTCGAGTTTAGTCAATGTGATACTAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114376    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_016792.2-2087s1c1
Sequence:CCGGGCTTCCATGTATGTGTATATTCTCGAGAATATACACATACATGGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114378    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016792.2-347s1c1
Sequence:CCGGGCAGTCTTCTTGGAAGTAGATCTCGAGATCTACTTCCAAGAAGACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114379    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016792.2-617s1c1
Sequence:CCGGCACGGCTTTGACAACTGTTTACTCGAGTAAACAGTTGTCAAAGCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114377    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_016792.2-679s1c1
Sequence:CCGGGCTCCTTATTACTGTGGCATTCTCGAGAATGCCACAGTAATAAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004786
VALIDATED
TXNL1 MISSION shRNA Bacterial Glycerol Stock
thioredoxin-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000296104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004786.2-806s21c1
Sequence:CCGGATAATGGTCAGGGCCCTAAATCTCGAGATTTAGGGCCCTGACCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-1163s21c1
Sequence:CCGGGCTCCTGGATAATTGCTTGATCTCGAGATCAAGCAATTATCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-998s21c1
Sequence:CCGGCGAATCAAGGTGAAGAGGAAACTCGAGTTTCCTCTTCACCTTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-529s21c1
Sequence:CCGGGCAGATGCTGTGGGATTAGAACTCGAGTTCTAATCCCACAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004786.2-466s21c1
Sequence:CCGGATATCAGCAACACCTACATTTCTCGAGAAATGTAGGTGTTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004786.1-1119s1c1
Sequence:CCGGGCTCCTGGATAATTGCTTGATCTCGAGATCAAGCAATTATCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-485s1c1
Sequence:CCGGGCAGATGCTGTGGGATTAGAACTCGAGTTCTAATCCCACAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-452s1c1
Sequence:CCGGCGAAACAAAGTGAGAATTGATCTCGAGATCAATTCTCACTTTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-954s1c1
Sequence:CCGGCGAATCAAGGTGAAGAGGAAACTCGAGTTTCCTCTTCACCTTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-899s1c1
Sequence:CCGGCCACTTCGTTATGTTAAGTTTCTCGAGAAACTTAACATAACGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004786
VALIDATED
TXNL1 MISSION shRNA shRNA Plasmid DNA
thioredoxin-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000296104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004786.2-806s21c1
Sequence:CCGGATAATGGTCAGGGCCCTAAATCTCGAGATTTAGGGCCCTGACCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-1163s21c1
Sequence:CCGGGCTCCTGGATAATTGCTTGATCTCGAGATCAAGCAATTATCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-998s21c1
Sequence:CCGGCGAATCAAGGTGAAGAGGAAACTCGAGTTTCCTCTTCACCTTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-529s21c1
Sequence:CCGGGCAGATGCTGTGGGATTAGAACTCGAGTTCTAATCCCACAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004786.2-466s21c1
Sequence:CCGGATATCAGCAACACCTACATTTCTCGAGAAATGTAGGTGTTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004786.1-1119s1c1
Sequence:CCGGGCTCCTGGATAATTGCTTGATCTCGAGATCAAGCAATTATCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-485s1c1
Sequence:CCGGGCAGATGCTGTGGGATTAGAACTCGAGTTCTAATCCCACAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-452s1c1
Sequence:CCGGCGAAACAAAGTGAGAATTGATCTCGAGATCAATTCTCACTTTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-954s1c1
Sequence:CCGGCGAATCAAGGTGAAGAGGAAACTCGAGTTTCCTCTTCACCTTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-899s1c1
Sequence:CCGGCCACTTCGTTATGTTAAGTTTCTCGAGAAACTTAACATAACGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004786
VALIDATED
TXNL1 MISSION shRNA Lentiviral Transduction Particles
thioredoxin-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000296104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004786.2-806s21c1
Sequence:CCGGATAATGGTCAGGGCCCTAAATCTCGAGATTTAGGGCCCTGACCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289070    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-1163s21c1
Sequence:CCGGGCTCCTGGATAATTGCTTGATCTCGAGATCAAGCAATTATCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289017    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-998s21c1
Sequence:CCGGCGAATCAAGGTGAAGAGGAAACTCGAGTTTCCTCTTCACCTTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289069    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004786.2-529s21c1
Sequence:CCGGGCAGATGCTGTGGGATTAGAACTCGAGTTCTAATCCCACAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296156    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004786.2-466s21c1
Sequence:CCGGATATCAGCAACACCTACATTTCTCGAGAAATGTAGGTGTTGCTGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064523    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004786.1-1119s1c1
Sequence:CCGGGCTCCTGGATAATTGCTTGATCTCGAGATCAAGCAATTATCCAGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064526    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-485s1c1
Sequence:CCGGGCAGATGCTGTGGGATTAGAACTCGAGTTCTAATCCCACAGCATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-452s1c1
Sequence:CCGGCGAAACAAAGTGAGAATTGATCTCGAGATCAATTCTCACTTTGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064525    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-954s1c1
Sequence:CCGGCGAATCAAGGTGAAGAGGAAACTCGAGTTTCCTCTTCACCTTGATTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064524    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004786.1-899s1c1
Sequence:CCGGCCACTTCGTTATGTTAAGTTTCTCGAGAAACTTAACATAACGAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks