EMAIL THIS PAGE TO A FRIEND

TXNL4A

thioredoxin-like 4A

Synonyms: DIB1 DIM1 HsT161 SNRNP15 TXNL4 U5-15kD
UniProtKB ID: P83876, B2RC18, O14834
Gene ID:
Mouse(27366) thioredoxin-like 4A
Rat(291415) thioredoxin-like 4A
Zebrafish(449780) thioredoxin-like 4A
domestic cat(101097277) thioredoxin-like 4A
Horse(100052390) thioredoxin-like 4A
dog(476156) thioredoxin-like 4A
chicken(420811) thioredoxin-like 4A
cow(535457) thioredoxin-like 4A
Goat(100861400) thioredoxin-like 4A
sheep(101122651) thioredoxin-like 4A
domestic guinea pig(100729143) thioredoxin-like 4A
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025299 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025299 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025299 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178604 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178604 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178604 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006701 Rosetta Predictions human pricing
NM_001038608 Rosetta Predictions mouse pricing
NM_001042408 Rosetta Predictions mouse pricing
NM_001042409 Rosetta Predictions mouse pricing
NM_025299 Rosetta Predictions mouse pricing
NM_178604 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157771 predicted 566
2 SASI_Hs01_00157772 predicted 297
3 SASI_Hs01_00157773 predicted 418
4 SASI_Hs01_00157774 predicted 355
5 SASI_Hs01_00157775 predicted 332
6 SASI_Hs01_00157776 predicted 363
7 SASI_Hs01_00157777 predicted 300
8 SASI_Hs01_00157778 predicted 576
9 SASI_Hs01_00157779 predicted 562
10 SASI_Hs01_00157780 predicted 559
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001038608 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00124947 predicted 420
2 SASI_Mm01_00124948 predicted 395
3 SASI_Mm01_00124949 predicted 457
4 SASI_Mm01_00124950 predicted 794
5 SASI_Mm01_00124951 predicted 723
6 SASI_Mm01_00124952 predicted 625
7 SASI_Mm01_00124953 predicted 396
8 SASI_Mm01_00124954 predicted 396
9 SASI_Mm01_00124956 predicted 378
10 SASI_Mm02_00289620 predicted 739
11 SASI_Mm01_00124955 predicted 332
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042408 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00077558 predicted 395
2 SASI_Mm01_00077559 predicted 380
3 SASI_Mm01_00077560 predicted 436
4 SASI_Mm01_00077561 predicted 764
5 SASI_Mm01_00077562 predicted 697
6 SASI_Mm01_00077563 predicted 605
7 SASI_Mm01_00077564 predicted 376
8 SASI_Mm01_00077565 predicted 376
9 SASI_Mm01_00077567 predicted 354
10 SASI_Mm02_00290369 predicted 714
11 SASI_Mm01_00077566 predicted 303
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00053810 predicted 476
2 SASI_Mm01_00053811 predicted 484
3 SASI_Mm01_00053812 predicted 620
4 SASI_Mm01_00053813 predicted 669
5 SASI_Mm01_00053814 predicted 524
6 SASI_Mm01_00053815 predicted 461
7 SASI_Mm01_00053816 predicted 399
8 SASI_Mm01_00053817 predicted 300
9 SASI_Mm01_00053818 predicted 327
10 SASI_Mm01_00053819 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025299 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00039334 predicted 465
2 SASI_Mm01_00039335 predicted 754
3 SASI_Mm01_00039336 predicted 338
4 SASI_Mm02_00327914 predicted 1038
5 SASI_Mm01_00039337 predicted 984
6 SASI_Mm01_00039338 predicted 1019
7 SASI_Mm01_00039339 predicted 305
8 SASI_Mm01_00039340 predicted 1040
9 SASI_Mm01_00039341 predicted 1034
10 SASI_Mm02_00327915 predicted 1030
11 SASI_Mm01_00039342 predicted 617
12 SASI_Mm01_00039343 predicted 443
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178604 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00022905 predicted 533
2 SASI_Mm01_00022906 predicted 508
3 SASI_Mm01_00022907 predicted 568
4 SASI_Mm01_00022908 predicted 903
5 SASI_Mm01_00022909 predicted 829
6 SASI_Mm01_00022910 predicted 743
7 SASI_Mm01_00022911 predicted 512
8 SASI_Mm01_00022912 predicted 508
9 SASI_Mm01_00022914 predicted 483
10 SASI_Mm02_00348945 predicted 852
11 SASI_Mm01_00022913 predicted 436
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006701
VALIDATED
TXNL4A MISSION shRNA Bacterial Glycerol Stock
thioredoxin-like 4A
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000064063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-368s1c1
Sequence:CCGGCGATCCATGTACTGTCATGTTCTCGAGAACATGACAGTACATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-539s1c1
Sequence:CCGGCAAGGACTACTCCACCAAGTACTCGAGTACTTGGTGGAGTAGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-426s1c1
Sequence:CCGGACTGGCAACAACAACAAGATTCTCGAGAATCTTGTTGTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-437s1c1
Sequence:CCGGCAACAAGATTAACTGGGCCATCTCGAGATGGCCCAGTTAATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000064066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-306s1c1
Sequence:CCGGGCAGTTATTTATCTTGTGGATCTCGAGATCCACAAGATAAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-368s21c1
Sequence:CCGGCGATCCATGTACTGTCATGTTCTCGAGAACATGACAGTACATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-539s21c1
Sequence:CCGGCAAGGACTACTCCACCAAGTACTCGAGTACTTGGTGGAGTAGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-437s21c1
Sequence:CCGGCAACAAGATTAACTGGGCCATCTCGAGATGGCCCAGTTAATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000311673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-426s21c1
Sequence:CCGGACTGGCAACAACAACAAGATTCTCGAGAATCTTGTTGTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006701
VALIDATED
TXNL4A MISSION shRNA shRNA Plasmid DNA
thioredoxin-like 4A
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000064063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-368s1c1
Sequence:CCGGCGATCCATGTACTGTCATGTTCTCGAGAACATGACAGTACATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-539s1c1
Sequence:CCGGCAAGGACTACTCCACCAAGTACTCGAGTACTTGGTGGAGTAGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-426s1c1
Sequence:CCGGACTGGCAACAACAACAAGATTCTCGAGAATCTTGTTGTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-437s1c1
Sequence:CCGGCAACAAGATTAACTGGGCCATCTCGAGATGGCCCAGTTAATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000064066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-306s1c1
Sequence:CCGGGCAGTTATTTATCTTGTGGATCTCGAGATCCACAAGATAAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-368s21c1
Sequence:CCGGCGATCCATGTACTGTCATGTTCTCGAGAACATGACAGTACATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-539s21c1
Sequence:CCGGCAAGGACTACTCCACCAAGTACTCGAGTACTTGGTGGAGTAGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-437s21c1
Sequence:CCGGCAACAAGATTAACTGGGCCATCTCGAGATGGCCCAGTTAATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000311673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-426s21c1
Sequence:CCGGACTGGCAACAACAACAAGATTCTCGAGAATCTTGTTGTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006701
VALIDATED
TXNL4A MISSION shRNA Lentiviral Transduction Particles
thioredoxin-like 4A
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000064063    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-368s1c1
Sequence:CCGGCGATCCATGTACTGTCATGTTCTCGAGAACATGACAGTACATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-539s1c1
Sequence:CCGGCAAGGACTACTCCACCAAGTACTCGAGTACTTGGTGGAGTAGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064065    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-426s1c1
Sequence:CCGGACTGGCAACAACAACAAGATTCTCGAGAATCTTGTTGTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064067    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-437s1c1
Sequence:CCGGCAACAAGATTAACTGGGCCATCTCGAGATGGCCCAGTTAATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000064066    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: A549
TRC Version: 1 Clone ID:NM_006701.2-306s1c1
Sequence:CCGGGCAGTTATTTATCTTGTGGATCTCGAGATCCACAAGATAAATAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311672    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-368s21c1
Sequence:CCGGCGATCCATGTACTGTCATGTTCTCGAGAACATGACAGTACATGGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311675    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-539s21c1
Sequence:CCGGCAAGGACTACTCCACCAAGTACTCGAGTACTTGGTGGAGTAGTCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311674    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-437s21c1
Sequence:CCGGCAACAAGATTAACTGGGCCATCTCGAGATGGCCCAGTTAATCTTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000311673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006701.2-426s21c1
Sequence:CCGGACTGGCAACAACAACAAGATTCTCGAGAATCTTGTTGTTGTTGCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025299
VALIDATED
TXNL4A MISSION shRNA Bacterial Glycerol Stock
thioredoxin-like 4A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000123684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025299.1-1031s1c1
Sequence:CCGGCCCTACTTACAAACACCAGTTCTCGAGAACTGGTGTTTGTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-417s1c1
Sequence:CCGGGAAGACAAGCAAGAAATGGTTCTCGAGAACCATTTCTTGCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-422s1c1
Sequence:CCGGCAAGCAAGAAATGGTTGACATCTCGAGATGTCAACCATTTCTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-425s1c1
Sequence:CCGGGCAAGAAATGGTTGACATCATCTCGAGATGATGTCAACCATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000123686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-296s1c1
Sequence:CCGGGCCTGACTTCAACAAGATGTACTCGAGTACATCTTGTTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025299
VALIDATED
TXNL4A MISSION shRNA shRNA Plasmid DNA
thioredoxin-like 4A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000123684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025299.1-1031s1c1
Sequence:CCGGCCCTACTTACAAACACCAGTTCTCGAGAACTGGTGTTTGTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-417s1c1
Sequence:CCGGGAAGACAAGCAAGAAATGGTTCTCGAGAACCATTTCTTGCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-422s1c1
Sequence:CCGGCAAGCAAGAAATGGTTGACATCTCGAGATGTCAACCATTTCTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-425s1c1
Sequence:CCGGGCAAGAAATGGTTGACATCATCTCGAGATGATGTCAACCATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000123686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-296s1c1
Sequence:CCGGGCCTGACTTCAACAAGATGTACTCGAGTACATCTTGTTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025299
VALIDATED
TXNL4A MISSION shRNA Lentiviral Transduction Particles
thioredoxin-like 4A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000123684    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025299.1-1031s1c1
Sequence:CCGGCCCTACTTACAAACACCAGTTCTCGAGAACTGGTGTTTGTAAGTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-417s1c1
Sequence:CCGGGAAGACAAGCAAGAAATGGTTCTCGAGAACCATTTCTTGCTTGTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123687    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-422s1c1
Sequence:CCGGCAAGCAAGAAATGGTTGACATCTCGAGATGTCAACCATTTCTTGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123685    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-425s1c1
Sequence:CCGGGCAAGAAATGGTTGACATCATCTCGAGATGATGTCAACCATTTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000123686    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025299.1-296s1c1
Sequence:CCGGGCCTGACTTCAACAAGATGTACTCGAGTACATCTTGTTGAAGTCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178604
TXNL4A MISSION shRNA Bacterial Glycerol Stock
thioredoxin-like 4A
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000114575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-1111s1c1
Sequence:CCGGGATGGCAAAGACAGCACTGATCTCGAGATCAGTGCTGTCTTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-792s1c1
Sequence:CCGGCAGGGCCATGATTGAGAACTTCTCGAGAAGTTCTCAATCATGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-937s1c1
Sequence:CCGGGCGTATGCTATGAAGCGAGATCTCGAGATCTCGCTTCATAGCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-817s1c1
Sequence:CCGGGCTAAGTATGTATCCCTGCATCTCGAGATGCAGGGATACATACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000114571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178604.2-1448s1c1
Sequence:CCGGGCTTTCTGCTTGGAATGCCAACTCGAGTTGGCATTCCAAGCAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178604
TXNL4A MISSION shRNA shRNA Plasmid DNA
thioredoxin-like 4A
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000114575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-1111s1c1
Sequence:CCGGGATGGCAAAGACAGCACTGATCTCGAGATCAGTGCTGTCTTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-792s1c1
Sequence:CCGGCAGGGCCATGATTGAGAACTTCTCGAGAAGTTCTCAATCATGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-937s1c1
Sequence:CCGGGCGTATGCTATGAAGCGAGATCTCGAGATCTCGCTTCATAGCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-817s1c1
Sequence:CCGGGCTAAGTATGTATCCCTGCATCTCGAGATGCAGGGATACATACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000114571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178604.2-1448s1c1
Sequence:CCGGGCTTTCTGCTTGGAATGCCAACTCGAGTTGGCATTCCAAGCAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178604
TXNL4A MISSION shRNA Lentiviral Transduction Particles
thioredoxin-like 4A
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000114575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-1111s1c1
Sequence:CCGGGATGGCAAAGACAGCACTGATCTCGAGATCAGTGCTGTCTTTGCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-792s1c1
Sequence:CCGGCAGGGCCATGATTGAGAACTTCTCGAGAAGTTCTCAATCATGGCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-937s1c1
Sequence:CCGGGCGTATGCTATGAAGCGAGATCTCGAGATCTCGCTTCATAGCATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178604.2-817s1c1
Sequence:CCGGGCTAAGTATGTATCCCTGCATCTCGAGATGCAGGGATACATACTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000114571    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178604.2-1448s1c1
Sequence:CCGGGCTTTCTGCTTGGAATGCCAACTCGAGTTGGCATTCCAAGCAGAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks